| Strain Information | |
|---|---|
| DGRC Number | 113080 |
| Genotype with FlyBase Link | w[*]; P{w[+mW.hs]=GawB}CG2162[NP3056] |
| Genotype | w*; P{w+mW.hs=GawB}CG2162NP3056 |
| Break points/Insertion Site | 63A3 |
| Map Viewer |  |
| Related Genes | aly CG2162 S-element{}915 |
| Original Number | 3056 |
| Chromosome | 3 |
| Comments | FlyBase Insertion: P{GawB}NP3056 NP line. Received from the National Institute of Genetics. |
| Cluster id | 1758 |
| General Information | NP_lines |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Embryonic Expression | weak |
| Larval GFP | fb, sg |
| Larval X-gal | sg, mt |
| Adult GFP | internal |
| Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
| Last update | 2020-04-03 |
| Research papers using this strain [Please submit your publication] |
Vaikakkara Chithran A, Allan DW, O'Connor TP. Adult expression of the cell adhesion protein Fasciclin 3 is required for the maintenance of adult olfactory interneurons. J Cell Sci (2024) 137(12) [PubMed ID = 38934299] [RRC reference] Rozenfeld E, Lerner H, Parnas M. Muscarinic Modulation of Antennal Lobe GABAergic Local Neurons Shapes Odor Coding and Behavior. Cell Rep (2019) 29(10) 3253-3265.e4 [PubMed ID = 31801087] [RRC reference] Mohamed AAM, Retzke T, Das Chakraborty S, Fabian B, Hansson BS, Knaden M, Sachse S. Odor mixtures of opposing valence unveil inter-glomerular crosstalk in the Drosophila antennal lobe. Nat Commun (2019) 10(1) 1201 [PubMed ID = 30867415] [RRC reference] Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
| Library & Clone Information |
|---|
| Library Name / Clone Name | np / np34555_0907 |
| Strand | Plus |
| Insertion Point | 3019025 |
| Chromosome Band | 3L |
| Flanking Sequence | acgtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggaccacctta tgttatttcatcatgGTCCAAGTCGAAGAAAAGCAAATCGCATCGGGAGCGCAGAGAACG CGCAAAGAAAACGACAACAGCTACAACGGCCGATAACGCCACTGTACTGGTTATATCAGC ATCTGAGAACGATACTCAATCCAACGAAGAACACCGACCGGCAAAGCCAGCGGACTGTGA TAAGGAGGTGTGTGTACTAAAACAAGACAAGAACGTATATAAGCGAATCTAAAGCCTATG AATTAGTTCTTATTAACAATAATTGTTCAGCGTAGCGCCATTCTCCATCAGCAGTTAGAA TTTTTTAATACACATTTTAATAGCTGACCTTGCCTTTCTAACATACAgatcgaagaatac ataagagagaaccgtcgccaaagaacccattattgttggggtccgttttcaggaagggca ngccatccgacatgtcatcctnttcagaccaatcaaatccatgaagagcatccctgggca taaaatccaacggaattgtggagttatcatgatgagctgccgagtcaatcgatacagtca actgnctttgacctttgttactactctcttccgatgatgatgtcgcacttattctatgct gnctcaatgttagaggcatatcagtctccactgagcnnnnnntttttnnggggnnnnnnn nnnnnnnnnnnnngnnnnnnnnngggccntnncncnnntnncnnnnnnnnnnnnnnnnnn nnnnnnnnnnannccnccnnnnggnannncncnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnngnnnnnnnngnncnnnnnnnnnnnnnnnannnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn |