Detailed Information [113094]
 

Strain Information
DGRC Number 113094
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP3084
Genotype y* w*; P{w+mW.hs=GawB}NP3084
Break points/Insertion Site 31F4
Map Viewer
Related Genes CG13144 CG6094 Myo31DF
Original Number 3084
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP3084

NP line. Received from the National Institute of Genetics.

Cluster id 1151
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression hg
Larval GFP sg, gut
Larval X-gal all gut
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Dai X, Zhang Q, Zhang G, Ma C, Zhang R.
Protective effect of agar oligosaccharide on male Drosophila melanogaster suffering from oxidative stress via intestinal microflora activating the Keap1-Nrf2 signaling pathway.
Carbohydr Polym (2023) 313 120878 [PubMed ID = 37182968] [RRC reference]

Wang Z, Zeng P, Zhou B.
Identification and characterization of a heme exporter from the MRP family in Drosophila melanogaster.
BMC Biol (2022) 20(1) 126 [PubMed ID = 35655259] [RRC reference]

Sattar Soltani
Investigating the function of novel players of iron homeostasis, heme metabolism and steroid hormone biosynthesis in Drosophila melanogaster
() [RRC reference]

Dong W, Zhang X, Kong Y, Zhao Z, Mahmoud A, Wu L, Moussian B, Zhang J.
CYP311A1 in the anterior midgut is involved in lipid distribution and microvillus integrity in Drosophila melanogaster.
Cell Mol Life Sci (2022) 79(5) 261 [PubMed ID = 35478270] [RRC reference]

Weaver LN, Ma T, Drummond-Barbosa D.
Analysis of Gal4 Expression Patterns in Adult Drosophila Females.
G3 (Bethesda) (2020) 10(11) 4147-4158 [PubMed ID = 32917721] [RRC reference]

Zhao M, Zhou B.
A distinctive sequence motif in the fourth transmembrane domain confers ZIP13 iron function in Drosophila melanogaster.
Biochim Biophys Acta Mol Cell Res (2020) 1867(2) 118607 [PubMed ID = 31733261] [RRC reference]

Xiao G, Liu ZH, Zhao M, Wang HL, Zhou B.
Transferrin 1 Functions in Iron Trafficking and Genetically Interacts with Ferritin in Drosophila melanogaster.
Cell Rep (2019) 26(3) 748-758.e5 [PubMed ID = 30650364] [RRC reference]

Yin S, Qin Q, Zhou B.
Functional studies of Drosophila zinc transporters reveal the mechanism for zinc excretion in Malpighian tubules.
BMC Biol (2017) 15(1) 12 [PubMed ID = 28196538] [RRC reference]

Tastekin I, Riedl J, Schilling-Kurz V, Gomez-Marin A, Truman JW, Louis M.
Role of the subesophageal zone in sensorimotor control of orientation in Drosophila larva.
Curr Biol (2015) 25(11) 1448-60 [PubMed ID = 25959970] [RRC reference]

Xiao G, Wan Z, Fan Q, Tang X, Zhou B.
The metal transporter ZIP13 supplies iron into the secretory pathway in Drosophila melanogaster.
Elife (2014) 3 e03191 [PubMed ID = 25006035] [RRC reference]

Qin Q, Wang X, Zhou B.
Functional studies of Drosophila zinc transporters reveal the mechanism for dietary zinc absorption and regulation.
BMC Biol (2013) 11 101 [PubMed ID = 24063361] [RRC reference]

Bonnay F, Cohen-Berros E, Hoffmann M, Kim SY, Boulianne GL, Hoffmann JA, Matt N, Reichhart JM.
big bang gene modulates gut immune tolerance in Drosophila.
Proc Natl Acad Sci U S A (2013) 110(8) 2957-62 [PubMed ID = 23378635] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np34775_0907
Strand Minus
Insertion Point 10499195
Chromosome Band 2L
Flanking Sequence
gtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggaccaccttatg
ttatttcatcatgGTCTGACCACAGTCCCTCTGCAACTTTCATTGAATGCGGTCGAGTGC
GGTTGTGCGACGGCCGATTGTTGTTATTAATCCGCCGCAAACGAAACTGAATCCAGGTGG
GCACTCACACCgatcgaagaatacataagagagaaccgtcgccaaagaacccattattgn
tggggtccgtnttcaggaaggncaagccatccgacatgtnatcctcttcagaccaatcaa
atccatgaagagcatccctgggcataaaatccaacgggatttgtgggagttatcatgatg
agctgccgagtcaatcgatacagtcaactgtctttgacctttggtactactctctttccg
atgatgatgtcgcacttatttctatgctgtctcaatgttagaggcatatcagtctccact
gaagcatnttttttttgggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnannnn
nnnnntnnncnnnnngnnnnnannnnnnnnnnnnnnnnnnnannnnnnnccttnnnnnnn
tnnnnnnnnnnnnnnnnnnnnngnnnnnnnnnnnnnnnnnnngnnnncnatnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

CLOSE