Strain Information | |
---|---|
DGRC Number | 113094 |
Genotype with FlyBase Link | y[*] w[*]; P{w[+mW.hs]=GawB}NP3084 |
Genotype | y* w*; P{w+mW.hs=GawB}NP3084 |
Break points/Insertion Site | 31F4 |
Map Viewer | |
Related Genes | CG13144 CG6094 Myo31DF |
Original Number | 3084 |
Chromosome | 2 |
Comments | FlyBase Insertion: P{GawB}NP3084 NP line. Received from the National Institute of Genetics. |
Cluster id | 1151 |
General Information | NP_lines |
Genus | Drosophila |
Subgenus | Sophophora |
Species Group | melanogaster |
Species Subgroup | melanogaster |
Species | melanogaster |
Embryonic Expression | hg |
Larval GFP | sg, gut |
Larval X-gal | all gut |
Adult GFP | internal |
Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
Last update | 2020-04-03 |
Research papers using this strain [Please submit your publication] |
Dai X, Zhang Q, Zhang G, Ma C, Zhang R. Protective effect of agar oligosaccharide on male Drosophila melanogaster suffering from oxidative stress via intestinal microflora activating the Keap1-Nrf2 signaling pathway. Carbohydr Polym (2023) 313 120878 [PubMed ID = 37182968] [RRC reference] Wang Z, Zeng P, Zhou B. Identification and characterization of a heme exporter from the MRP family in Drosophila melanogaster. BMC Biol (2022) 20(1) 126 [PubMed ID = 35655259] [RRC reference] Sattar Soltani Investigating the function of novel players of iron homeostasis, heme metabolism and steroid hormone biosynthesis in Drosophila melanogaster () [RRC reference] Dong W, Zhang X, Kong Y, Zhao Z, Mahmoud A, Wu L, Moussian B, Zhang J. CYP311A1 in the anterior midgut is involved in lipid distribution and microvillus integrity in Drosophila melanogaster. Cell Mol Life Sci (2022) 79(5) 261 [PubMed ID = 35478270] [RRC reference] Weaver LN, Ma T, Drummond-Barbosa D. Analysis of Gal4 Expression Patterns in Adult Drosophila Females. G3 (Bethesda) (2020) 10(11) 4147-4158 [PubMed ID = 32917721] [RRC reference] Zhao M, Zhou B. A distinctive sequence motif in the fourth transmembrane domain confers ZIP13 iron function in Drosophila melanogaster. Biochim Biophys Acta Mol Cell Res (2020) 1867(2) 118607 [PubMed ID = 31733261] [RRC reference] Xiao G, Liu ZH, Zhao M, Wang HL, Zhou B. Transferrin 1 Functions in Iron Trafficking and Genetically Interacts with Ferritin in Drosophila melanogaster. Cell Rep (2019) 26(3) 748-758.e5 [PubMed ID = 30650364] [RRC reference] Yin S, Qin Q, Zhou B. Functional studies of Drosophila zinc transporters reveal the mechanism for zinc excretion in Malpighian tubules. BMC Biol (2017) 15(1) 12 [PubMed ID = 28196538] [RRC reference] Tastekin I, Riedl J, Schilling-Kurz V, Gomez-Marin A, Truman JW, Louis M. Role of the subesophageal zone in sensorimotor control of orientation in Drosophila larva. Curr Biol (2015) 25(11) 1448-60 [PubMed ID = 25959970] [RRC reference] Xiao G, Wan Z, Fan Q, Tang X, Zhou B. The metal transporter ZIP13 supplies iron into the secretory pathway in Drosophila melanogaster. Elife (2014) 3 e03191 [PubMed ID = 25006035] [RRC reference] Qin Q, Wang X, Zhou B. Functional studies of Drosophila zinc transporters reveal the mechanism for dietary zinc absorption and regulation. BMC Biol (2013) 11 101 [PubMed ID = 24063361] [RRC reference] Bonnay F, Cohen-Berros E, Hoffmann M, Kim SY, Boulianne GL, Hoffmann JA, Matt N, Reichhart JM. big bang gene modulates gut immune tolerance in Drosophila. Proc Natl Acad Sci U S A (2013) 110(8) 2957-62 [PubMed ID = 23378635] [RRC reference] Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
Stock Request |
Library & Clone Information |
---|
Library Name / Clone Name | np / np34775_0907 |
Strand | Minus |
Insertion Point | 10499195 |
Chromosome Band | 2L |
Flanking Sequence | gtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggaccaccttatg ttatttcatcatgGTCTGACCACAGTCCCTCTGCAACTTTCATTGAATGCGGTCGAGTGC GGTTGTGCGACGGCCGATTGTTGTTATTAATCCGCCGCAAACGAAACTGAATCCAGGTGG GCACTCACACCgatcgaagaatacataagagagaaccgtcgccaaagaacccattattgn tggggtccgtnttcaggaaggncaagccatccgacatgtnatcctcttcagaccaatcaa atccatgaagagcatccctgggcataaaatccaacgggatttgtgggagttatcatgatg agctgccgagtcaatcgatacagtcaactgtctttgacctttggtactactctctttccg atgatgatgtcgcacttatttctatgctgtctcaatgttagaggcatatcagtctccact gaagcatnttttttttgggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnannnn nnnnntnnncnnnnngnnnnnannnnnnnnnnnnnnnnnnnannnnnnnccttnnnnnnn tnnnnnnnnnnnnnnnnnnnnngnnnnnnnnnnnnnnnnnnngnnnncnatnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn |