| Strain Information | |
|---|---|
| DGRC Number | 113165 |
| Genotype with FlyBase Link | w[*]; P{w[+mW.hs]=GawB}NP3222 |
| Genotype | w*; P{w+mW.hs=GawB}NP3222 |
| Break points/Insertion Site | 42B2 |
| Map Viewer |  |
| Related Genes | 1.28 F-element{}755 |
| Original Number | 3222 |
| Chromosome | 2 |
| Comments | FlyBase Insertion: P{GawB}NP3222 y[*] seems to be fixed. 12April2012 M.T. |
| Original Comments | comment1:A, comment2:42A13-A16 |
| Cluster id | 531 |
| General Information | NP_lines |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Embryonic Expression | muscle |
| Larval GFP | no gfp larva |
| Larval X-gal | tibia and trochanter of leg, outring of wing pouch, AII in antenna, |
| Adult GFP | ubiquitous |
| Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
| Last update | 2020-04-03 |
| Research papers using this strain [Please submit your publication] |
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
| Stock Request | |
| Library & Clone Information |
|---|
| Library Name / Clone Name | np / np16115_0727 |
| Strand | Plus |
| Insertion Point | 1562782 |
| Chromosome Band | 2R |
| Flanking Sequence | gnnggngngnnnnnnnaggggnnnnngnnnnnnnngtttttttnnggnattaactgtggg ncaaagncncttntttgngtgacttcggtaagccttcggctatcgacgggnaccacctta tgttatttcatcatgTGCCCGGTTCTAGTTGGCTAAGCCATTCGGCTGGCACTCGGTCCG CCGCCTCGCTTCTCGTCGGCTACCTCTTCGGGTGGGGCCGCAGCGCTCGGTCCACTCCCA CTCCACTTGGCCCCACTCGTCAGTCAGTCGGCAGGCAGAGCAAGAGCAGCCCGCAGCTTT TTCGTGGGGAgatcgaagaatacataagagagaaccgtcgccaaagaacccattattgtt ggggtccgttttcaggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaa tccatgaagagcatccctgggcataaaatccaacggaattgtggagttatcatgatgagc tgccgagtcaatcgatacagtcaactgtctttgacctttgttactactctcttccgatga tgatgtcgcacttattctatgctgtctcaatgttagaggcatatcagtctccactgagct tttttttttnggggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngnnnnnnnannnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnn |
