| Strain Information | |
|---|---|
| DGRC Number | 113183 |
| Genotype with FlyBase Link | y[*] w[*]; P{w[+mW.hs]=GawB}ptc[NP3253] / CyO, P{w[-]=UAS-lacZ.UW14}UW14 |
| Genotype | y* w*; P{w+mW.hs=GawB}ptcNP3253 / CyO, P{w-=UAS-lacZ.UW14}UW14 |
| Break points/Insertion Site | 44D8 |
| Map Viewer |  |
| Related Genes | ptc CG30353 CG8635 |
| Original Number | 3253 |
| Chromosome | 2 |
| Comments | FlyBase Insertion: P{GawB}NP3253 NP line. Received from the National Institute of Genetics. |
| Balancer | CyUW14 |
| Cluster id | 600 |
| General Information | NP_lines |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Embryonic Expression | epi strip (TU) |
| Larval GFP | cns, epi |
| Larval X-gal | center of antenna, |
| Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
| Last update | 2020-04-03 |
| Research papers using this strain [Please submit your publication] |
Nguyen QD, Fujii K, Ishibashi K, Hashiba H, Ohtsubo W, Kitazawa H, Tanimoto H, Fuse N, Kurata S. Regulation of Gut Starvation Responses Through Drosophila NP3253 Neurons. Genes Cells (2025) 30(2) e70005 [PubMed ID = 39904737] [RRC reference] Fuse N, Hashiba H, Ishibashi K, Suzuki T, Nguyen QD, Fujii K, Ikeda-Ohtsubo W, Kitazawa H, Tanimoto H, Kurata S. Neural control of redox response and microbiota-triggered inflammation in Drosophila gut. Front Immunol (2023) 14 1268611 [PubMed ID = 37965334] [RRC reference] Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
| Library & Clone Information |
|---|
| Library Name / Clone Name | np / np36135_0907 |
| Strand | Plus |
| Insertion Point | 3716376 |
| Chromosome Band | 2R |
| Flanking Sequence | gcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggaccaccttatgtt atttcatcatgGTCTGAGGTCTCGGCGAAGCAAGACATAACAACGGCCCGACAGAGAGAG AGAAGAAAAATCGGGAGAATTATGAAGACATTAACTCGACCACACAGCACGCTGCCGTAC CCGTACCTATATACCTATACCCAACCCATAACCATACACACACACACACGCATCAACACA CACACACACGAACAGACNGGCCCAAAAACTCGAAACCCCAGCAGAGAGAAGNGGGGGCTT ACTTACGTTACgatcgaagaatacataagagagaaccgtcgccaaagaacccattattgg tggggtccgttttcaggaagggcaagccatccgacatgtnatnctcttcagaccaatcaa atccatgaagagcatccctgggcataaaatccaacggaattgnggagttatcatgatgag ctgccgagtcaatcgatacagncaactgtcttttgacctttgttactactctcttncgat gatgatgtcgcacttattctatgctgtctcantgtnagaggcatatcagtctccactgag catnttnttttttgggggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnn |
| Image Files | ||
|---|---|---|
| Disc |
|
|
