| Strain Information | |
|---|---|
| DGRC Number | 113336 |
| Genotype with FlyBase Link | w[*]; P{w[+mW.hs]=GawB}Eip75B[NP3547] |
| Genotype | w*; P{w+mW.hs=GawB}Eip75BNP3547 |
| Break points/Insertion Site | 75B2 |
| Map Viewer |  |
| Related Genes | CG32192 Eip75B |
| Original Number | 3547 |
| Chromosome | 3 |
| Comments | FlyBase Insertion: P{GawB}NP3547 NP line. Received from the National Institute of Genetics. |
| Cluster id | 1960 |
| General Information | NP_lines |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Embryonic Expression | cns+pns (SG), sg, cns (TU) |
| Larval GFP | tr node associated cell, mt |
| Larval X-gal | sg, ring gland, |
| Adult GFP | proximal leg (femur and more prox), bodywall. notum. |
| Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
| Last update | 2020-04-03 |
| Research papers using this strain [Please submit your publication] |
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
| Stock Request | |
| Library & Clone Information |
|---|
| Library Name / Clone Name | np / np15955_0727 |
| Strand | Plus |
| Insertion Point | 17922079 |
| Chromosome Band | 3L |
| Flanking Sequence | ttttttgcctgaaactagtgtatacttcggtaagcttcggctatcgacgggaccacctta tgttatttcatcatgGCCATACCCATAGCCTGCTCTCTCTCTTTCTCTCTGCCCACTGTT CTCCCTGACGTGCTCCCCCGTCCCATCGCACACTCTCTTTGTGGCCTCCCCCTTTTTTCg atcgaagaatacataagagagaaccgtcgccaaagaacccattattgttggggtccgttt tcaggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaatccatgaagag catccctgggcataaaatccaacggaattgtggagttatcatgatgagctgccgagtcaa tcgatacagtcaactgtctttgacctttggtactactctcttccgatgatgatgtcgcac ttattctatgctgtctcaatggtagaggcatatcagtctccactgaagccaatcttantc tgggnnnnnnnnntnnnannnnnnannnnnnnnnntnancnnnnnngnnnnangggnnnn ngntnnnnnnnnnnncncnnngggncnnnnnnnngnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnncnnnnnnnnnnnnnnnnntnnnnnnngnnn nnnnnnnnnnnntnnnnnnnnnnnnnnnnnnnnnnnnnngnnnnntnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnntnnnnnngnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnn |