| Strain Information | |
|---|---|
| DGRC Number | 113449 |
| Genotype with FlyBase Link | y[*] w[*]; P{w[+mW.hs]=GawB}cpo[NP4429] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1 |
| Genotype | y* w*; P{w+mW.hs=GawB}cpoNP4429 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1 |
| Break points/Insertion Site | 90D1 |
| Map Viewer |  |
| Related Genes | cpo DNaseII H-element{}1380 |
| Original Number | 4429 |
| Chromosome | 3 |
| Comments | FlyBase Insertion: P{GawB}NP4429 NP line. Received from the National Institute of Genetics. |
| Balancer | TM6UW23-1 |
| Cluster id | 1529 |
| General Information | NP_lines |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Lethality | lethal |
| Embryonic Expression | a part of mesoderm? |
| Larval GFP | uniform epi tr. |
| Larval X-gal | no gfp |
| Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
| Last update | 2021-11-11 |
| Research papers using this strain [Please submit your publication] |
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
| Stock Request | |
| Library & Clone Information |
|---|
| Library Name / Clone Name | np / np16885_0727 |
| Strand | Minus |
| Insertion Point | 13769814 |
| Chromosome Band | 3R |
| Flanking Sequence | antttctttggggtgaaaaagccccttttttggntacttcggaaagccttcggctatcga cgggaccaccttatgttatttcatcatgGCCTGAACTTAAAACGCTGCCTTCGGCTCTCG CTCGGCACTCGCTCGGCTGCGACGTCGACTGCGACGCTGGCAGCGACAACAACGATTGGC CTCTCTCATTCACTTACCTCCTCTCTCTCTCTCGCNTTTTTTNTTAGCGGNGAGAGAGTG TTTTCCTCACATTTGTTTTGCTTTTGCGGTTCGCCAATGGCCCCCCAAAACGAAAAGAGC GCGCAAGAGCTAGCTCCACAGTGgatcgaagaatacataagagagaaccgtcgccaaaga acccattattgttggggtccgttttcaggaagggcaagccatccgacatgtcatcctctt cagaccaatcaaatccatgaagagcatccctgggcataaaatccaacggaattgtggagt tatcatgatgagctgccgagtcaatcgatacagtcaactgtctttgacctttgttactac tctcttccgatgatgatgtcgcacttattctatgctgtctcaatgttagaggcatatcag tctccactgagcatnttttttttggggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn |