Strain Information | |
---|---|
DGRC Number | 113511 |
Genotype with FlyBase Link | w[*]; P{w[+mW.hs]=GawB}Sir2[NP4739] / CyO; TM3, Sb[1] Ser[1] |
Genotype | w*; P{w+mW.hs=GawB}Sir2NP4739 / CyO; TM3, Sb1 Ser1 |
Break points/Insertion Site | --- |
Map Viewer | |
Related Genes | CG16975 Sir2 CG9828 |
Original Number | 4739 |
Chromosome | A |
Comments | FlyBase Insertion: P{GawB}NP4739 NP line. Received from the National Institute of Genetics. |
Original Comments | comment1:A, comment2:34A8-A9 |
Balancer | CyO; TM3 Sb Ser |
Cluster id | 1174 |
General Information | NP_lines |
Genus | Drosophila |
Subgenus | Sophophora |
Species Group | melanogaster |
Species Subgroup | melanogaster |
Species | melanogaster |
Embryonic Expression | ubiquitous epi (SG) |
Larval GFP | no larva |
Larval X-gal | ubiquitous |
Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
Last update | 2020-04-03 |
Research papers using this strain [Please submit your publication] |
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
Stock Request |
Library & Clone Information |
---|
Library Name / Clone Name | np / np25035_0807 |
Strand | Minus |
Insertion Point | 13154784 |
Chromosome Band | 2L |
Flanking Sequence | atnttttggtgcactgactttaattgtatacttcggtaagcttcggctatcgacgggacc accttatgttatttcatcatgTGCTGGCTCTTCTTCTTCTTGCGCGAGTGTTTCCTCGGT CTCTCCGCTTTGCGCTCTCGCCTCGTCCGTTTTCTCCGCTCTTTCGTTGGTACACACAAA AATTTTTACGTCGTCAGCTTCGCACCCATTTGGCTTGATTGAAAAAATTCTCCAGCgatc gaagaatacataagagagaaccgtcgccaaagaacccattattgttggggnccgttttca ggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaatccatgaagagcat ccctgggcataaaatccaacggaattgtggagttatcatgatgagctgccgagtcaatcg atacagtcaactgtctttgacctttggtactactctcttccgatgatgatgtcgcactta ttctatgctgtctcaatgntagaggcatatcagtctccactgagcatnnnnnnnnttggg nnnnnnnnnnnnnnngggnngannncnnnnnnnntacannnnncantgnnnnaatnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnggnnnnnnnnnnnnnnnnnnnnnnnnnnnnn gnnnnnnnnnnnnnnnnnnnngnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nn |