| Strain Information | |
|---|---|
| DGRC Number | 113602 |
| Genotype with FlyBase Link | y[*] w[*]; P{w[+mW.hs]=GawB}NP5137 / CyO, P{w[-]=UAS-lacZ.UW14}UW14 |
| Genotype | y* w*; P{w+mW.hs=GawB}NP5137 / CyO, P{w-=UAS-lacZ.UW14}UW14 |
| Break points/Insertion Site | --- |
| Map Viewer |  |
| Related Genes | CG40413 CG40420 |
| Original Number | 5137 |
| Chromosome | 2 |
| Comments | FlyBase Insertion: P{GawB}NP5137 NP line. Received from the National Institute of Genetics. |
| Balancer | CyUW14 |
| Cluster id | 2145 |
| General Information | NP_lines |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Embryonic Expression | weak |
| Larval GFP | sh. sg only |
| Larval X-gal | sh. Not in disc. CNS. |
| Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
| Last update | 2020-04-03 |
| Research papers using this strain [Please submit your publication] |
Sterne GR, Otsuna H, Dickson BJ, Scott K. Classification and genetic targeting of cell types in the primary taste and premotor center of the adult Drosophila brain. Elife (2021) 10 [PubMed ID = 34473057] [RRC reference] Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
| Stock Request | |
| Library & Clone Information |
|---|
| Library Name / Clone Name | np / np45355_0912 |
| Strand | Plus |
| Insertion Point | 7054708 |
| Chromosome Band | U |
| Flanking Sequence | ctgttaacgtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggacc accttatgttatttATCATGGGTTCGCTGTAGCGCTCTTCGCTCTCTCGCTCTCTAACAA AAATTCGAGAGAGCCTGGAGCCACCTCTAGAGCCACGGCCAAAAAATTGTGTGCCAAAAA AATTGTATGGCGTTACGCATCTTGTTATTCTAGTGTCTTTGGTACTACCAACAATTCACC TTTAGTGCAATCGCAAATGTTTTTGGCGAGATAAGGAGTTGTTGAAAAGCTTTGTTTGGT ATATAAAGAGAAACTAAGCGGCAAAACgatcgaagaatacataagagagaaccgtcgcca aagaacccattattgttggggtccgttttcaggaagggcaagccatccgacatgtcatcc tcttcagaccaatcaaatccatgaagagcatccctgggcataaaatccaacggaattgtg gagttatcatgatgagctgccgagtcaatcgatacagtcaactgtctttgaccctttgtt actacttctcttccgatgatgatgtcgcacttattctatgctgtctcaatgttagaggca tatcagtctccngntnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnc |