Detailed Information [113602]
Strain Information
DGRC Number 113602
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP5137 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}NP5137 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site ---
Map Viewer
Related Genes CG40413 CG40420
Original Number 5137
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP5137

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 2145
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression weak
Larval GFP sh. sg only
Larval X-gal sh. Not in disc. CNS.
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Sterne GR, Otsuna H, Dickson BJ, Scott K.
Classification and genetic targeting of cell types in the primary taste and premotor center of the adult Drosophila brain.
Elife (2021) 10 [PubMed ID = 34473057] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]

Library & Clone Information
Library Name / Clone Name np / np45355_0912
Strand Plus
Insertion Point 7054708
Chromosome Band U
Flanking Sequence
ctgttaacgtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggacc
accttatgttatttATCATGGGTTCGCTGTAGCGCTCTTCGCTCTCTCGCTCTCTAACAA
AAATTCGAGAGAGCCTGGAGCCACCTCTAGAGCCACGGCCAAAAAATTGTGTGCCAAAAA
AATTGTATGGCGTTACGCATCTTGTTATTCTAGTGTCTTTGGTACTACCAACAATTCACC
TTTAGTGCAATCGCAAATGTTTTTGGCGAGATAAGGAGTTGTTGAAAAGCTTTGTTTGGT
ATATAAAGAGAAACTAAGCGGCAAAACgatcgaagaatacataagagagaaccgtcgcca
aagaacccattattgttggggtccgttttcaggaagggcaagccatccgacatgtcatcc
tcttcagaccaatcaaatccatgaagagcatccctgggcataaaatccaacggaattgtg
gagttatcatgatgagctgccgagtcaatcgatacagtcaactgtctttgaccctttgtt
actacttctcttccgatgatgatgtcgcacttattctatgctgtctcaatgttagaggca
tatcagtctccngntnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnc

CLOSE