| Strain Information | |
|---|---|
| DGRC Number | 113901 |
| Genotype with FlyBase Link | y[*] w[*]; P{w[+mW.hs]=GawB}NP6301 / CyO, P{w[-]=UAS-lacZ.UW14}UW14 |
| Genotype | y* w*; P{w+mW.hs=GawB}NP6301 / CyO, P{w-=UAS-lacZ.UW14}UW14 |
| Break points/Insertion Site | 38B1 |
| Map Viewer | ![]() |
| Related Genes | CG10659 sNPF |
| Original Number | 6301 |
| Chromosome | 2 |
| Comments | FlyBase Insertion: P{GawB}NP6301 NP line. Received from the National Institute of Genetics. |
| Also known as | snpf-Gal4 |
| Balancer | CyUW14 |
| Cluster id | 1258 |
| General Information | NP_lines |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Embryonic Expression | sg only |
| Larval GFP | sg |
| Larval X-gal | sg, |
| Adult GFP | internal |
| Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
| Last update | 2022-02-16 |
| Research papers using this strain [Please submit your publication] |
Yoshinari Y, Nishimura T, Yoshii T, Kondo S, Tanimoto H, Kobayashi T, Matsuyama M, Niwa R. A high-protein diet-responsive gut hormone regulates behavioral and metabolic optimization in Drosophila melanogaster. Nat Commun (2024) 15(1) 10819 [PubMed ID = 39737959] [RRC reference] Megha, Wegener C, Hasan G. ER-Ca2+ sensor STIM regulates neuropeptides required for development under nutrient restriction in Drosophila. PLoS One (2019) 14(7) e0219719 [PubMed ID = 31295329] [RRC reference] Sawala A, Gould AP. The sex of specific neurons controls female body growth in Drosophila. PLoS Biol (2017) 15(10) e2002252 [PubMed ID = 28976974] [RRC reference] Okamoto N, Nishimura T. Signaling from Glia and Cholinergic Neurons Controls Nutrient-Dependent Production of an Insulin-like Peptide for Drosophila Body Growth. Dev Cell (2015) 35(3) 295-310 [PubMed ID = 26555050] [RRC reference] Schoofs A, Huckesfeld S, Schlegel P, Miroschnikow A, Peters M, Zeymer M, Spies R, Chiang AS, Pankratz MJ. Selection of motor programs for suppressing food intake and inducing locomotion in the Drosophila brain. PLoS Biol (2014) 12(6) e1001893 [PubMed ID = 24960360] [RRC reference] Shang Y, Donelson NC, Vecsey CG, Guo F, Rosbash M, Griffith LC. Short neuropeptide F is a sleep-promoting inhibitory modulator. Neuron (2013) 80(1) 171-83 [PubMed ID = 24094110] [RRC reference] Chen W, Shi W, Li L, Zheng Z, Li T, Bai W, Zhao Z. Regulation of sleep by the short neuropeptide F (sNPF) in Drosophila melanogaster. Insect Biochem Mol Biol (2013) 43(9) 809-19 [PubMed ID = 23796436] [RRC reference] Nassel DR, Enell LE, Santos JG, Wegener C, Johard HA. A large population of diverse neurons in the Drosophila central nervous system expresses short neuropeptide F, suggesting multiple distributed peptide functions. BMC Neurosci (2008) 9 90 [PubMed ID = 18803813] [RRC reference] Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
| Library & Clone Information |
|---|
| Library Name / Clone Name | np / np48015_0912 |
| Strand | Minus |
| Insertion Point | 20005962 |
| Chromosome Band | 2L |
| Flanking Sequence | ttttttngtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggacca ccttatgttatttcatcatgAGCCAGCCGTAAAAGCCGAATTCCTCCCGAAACCCAACGA AGTTGATGATGTCGGCATGTGGCAGGCAGTTCAACTTCAACTGGTTGCTCCTGTTGCTTC TTCAATCAAAAGCTTTTCCTGCTAGCCGGCTACCCGAGGTTTGAGTCCTCGCTAATGGAG AACATTTTGCCGCCCACGCATTTTATACCCTCATTTGTGAATTGAAGTGGGAGGTATTTC gatcgaagaatacataagagagaaccgtcgccaaagaacccattattgttggggtccgtt ttcaggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaatccatgaaga gcatccctgggcataaaatccaacggaattgtggagttatcatgatgagctgccgagtca atcgatacagtcaactgtctttgacctttgttactactctcttccgatgatgatgtcgca cttattctatgctgtctcaatgttagaggcatatcagtctccactgagctctnntttttt gggggnnnnnnnnnnnnnnnnnnnnnnnnnntnnnnnntnccnctnnnnccatnnnnnnn tnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncnnnncnnnnntcnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnncccnnnnnnnnnnnnnnnnntnnnnnnnnnnnnnnnnnnn nnnnnnnncnnnnnnnnnnnnncnncnnnnnnncnnnnttnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnncnnnnnnnnnnnntcnnnnnnnnnnn |