Detailed Information [113901]
Strain Information
DGRC Number 113901
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP6301 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}NP6301 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 38B1
Map Viewer
Related Genes CG10659 sNPF
Original Number 6301
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP6301

NP line. Received from the National Institute of Genetics.

Also known as snpf-Gal4
Balancer CyUW14
Cluster id 1258
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression sg only
Larval GFP sg
Larval X-gal sg,
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2022-02-16
Research papers using this strain
[Please submit your publication]
Yoshinari Y, Nishimura T, Yoshii T, Kondo S, Tanimoto H, Kobayashi T, Matsuyama M, Niwa R.
A high-protein diet-responsive gut hormone regulates behavioral and metabolic optimization in Drosophila melanogaster.
Nat Commun (2024) 15(1) 10819 [PubMed ID = 39737959] [RRC reference]

Megha, Wegener C, Hasan G.
ER-Ca2+ sensor STIM regulates neuropeptides required for development under nutrient restriction in Drosophila.
PLoS One (2019) 14(7) e0219719 [PubMed ID = 31295329] [RRC reference]

Sawala A, Gould AP.
The sex of specific neurons controls female body growth in Drosophila.
PLoS Biol (2017) 15(10) e2002252 [PubMed ID = 28976974] [RRC reference]

Okamoto N, Nishimura T.
Signaling from Glia and Cholinergic Neurons Controls Nutrient-Dependent Production of an Insulin-like Peptide for Drosophila Body Growth.
Dev Cell (2015) 35(3) 295-310 [PubMed ID = 26555050] [RRC reference]

Schoofs A, Huckesfeld S, Schlegel P, Miroschnikow A, Peters M, Zeymer M, Spies R, Chiang AS, Pankratz MJ.
Selection of motor programs for suppressing food intake and inducing locomotion in the Drosophila brain.
PLoS Biol (2014) 12(6) e1001893 [PubMed ID = 24960360] [RRC reference]

Shang Y, Donelson NC, Vecsey CG, Guo F, Rosbash M, Griffith LC.
Short neuropeptide F is a sleep-promoting inhibitory modulator.
Neuron (2013) 80(1) 171-83 [PubMed ID = 24094110] [RRC reference]

Chen W, Shi W, Li L, Zheng Z, Li T, Bai W, Zhao Z.
Regulation of sleep by the short neuropeptide F (sNPF) in Drosophila melanogaster.
Insect Biochem Mol Biol (2013) 43(9) 809-19 [PubMed ID = 23796436] [RRC reference]

Nassel DR, Enell LE, Santos JG, Wegener C, Johard HA.
A large population of diverse neurons in the Drosophila central nervous system expresses short neuropeptide F, suggesting multiple distributed peptide functions.
BMC Neurosci (2008) 9 90 [PubMed ID = 18803813] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]

Library & Clone Information
Library Name / Clone Name np / np48015_0912
Strand Minus
Insertion Point 20005962
Chromosome Band 2L
Flanking Sequence
ttttttngtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggacca
ccttatgttatttcatcatgAGCCAGCCGTAAAAGCCGAATTCCTCCCGAAACCCAACGA
AGTTGATGATGTCGGCATGTGGCAGGCAGTTCAACTTCAACTGGTTGCTCCTGTTGCTTC
TTCAATCAAAAGCTTTTCCTGCTAGCCGGCTACCCGAGGTTTGAGTCCTCGCTAATGGAG
AACATTTTGCCGCCCACGCATTTTATACCCTCATTTGTGAATTGAAGTGGGAGGTATTTC
gatcgaagaatacataagagagaaccgtcgccaaagaacccattattgttggggtccgtt
ttcaggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaatccatgaaga
gcatccctgggcataaaatccaacggaattgtggagttatcatgatgagctgccgagtca
atcgatacagtcaactgtctttgacctttgttactactctcttccgatgatgatgtcgca
cttattctatgctgtctcaatgttagaggcatatcagtctccactgagctctnntttttt
gggggnnnnnnnnnnnnnnnnnnnnnnnnnntnnnnnntnccnctnnnnccatnnnnnnn
tnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncnnnncnnnnntcnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnncccnnnnnnnnnnnnnnnnntnnnnnnnnnnnnnnnnnnn
nnnnnnnncnnnnnnnnnnnnncnncnnnnnnncnnnnttnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnncnnnnnnnnnnnntcnnnnnnnnnnn

CLOSE