| Strain Information | |
|---|---|
| DGRC Number | 113920 |
| Genotype with FlyBase Link | y[*] w[*]; P{w[+mW.hs]=GawB}Pen[NP6333] / CyO, P{w[-]=UAS-lacZ.UW14}UW14 |
| Genotype | y* w*; P{w+mW.hs=GawB}PenNP6333 / CyO, P{w-=UAS-lacZ.UW14}UW14 |
| Break points/Insertion Site | 31A1; -; 31A2 |
| Map Viewer | ![]() |
| Related Genes | CG4791 Pen CG4804 |
| Original Number | 6333 |
| Chromosome | 2 |
| Comments | FlyBase Insertion: P{GawB}NP6333 NP line. Received from the National Institute of Genetics. |
| Balancer | CyUW14 |
| Cluster id | 1145 |
| General Information | NP_lines |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Embryonic Expression | CNS, sg (TU). weak |
| Larval GFP | wing, hal, genital, tr pit, tr hb. |
| Larval X-gal | ubiquitous in discs, CNS, gut, |
| Adult GFP | internal |
| Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
| Last update | 2020-04-03 |
| Research papers using this strain [Please submit your publication] |
Ridgway AM, Hood EJ, Jimenez JF, Nunes MDS, McGregor AP. Sox21b underlies the rapid diversification of a novel male genital structure between Drosophila species. Curr Biol (2024) 34(5) 1114-1121.e7 [PubMed ID = 38309269] [RRC reference] Tang HY, Smith-Caldas MS, Driscoll MV, Salhadar S, Shingleton AW. FOXO regulates organ-specific phenotypic plasticity in Drosophila. PLoS Genet (2011) 7(11) e1002373 [PubMed ID = 22102829] [RRC reference] Stieper BC, Kupershtok M, Driscoll MV, Shingleton AW. Imaginal discs regulate developmental timing in Drosophila melanogaster. Dev Biol (2008) 321(1) 18-26 [PubMed ID = 18632097] [RRC reference] Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
| Stock Request | |
| Library & Clone Information |
|---|
| Library Name / Clone Name | np / np48255_0912 |
| Strand | Minus |
| Insertion Point | 10049462 |
| Chromosome Band | 2L |
| Flanking Sequence | cgtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggaccaccttat gttatttcatcatgCTGTAGACAAACGTAGACAGTACTCTCGTAATCGATGCGAAATTGG AGTCAATGCCTGCTTGGCGCCGCCAGAATTTACCGTTTGATTTGAAAAGCAAGCCTTAGT GGCGAACGAAACGCAGATGGCTATCgatcgaagaatacataagagagaaccgtcgccaaa gaacccattattgttggggtccgttttcaggaagggcaagccatccgacatgtcatcctc ttcagaccaatcaaatccatgaagagcatccctgggcataaaatccaacggaattgtgga gttatcatgatgagctgccgagtcaatcgatacaggcaactggctttgaccnttggtact actctnttccgangaagaaggcccncttnttttttgccggctcaanggtaangggantta annnccncnaacccnnnnntnnngnggggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn |