| Strain Information | |
|---|---|
| DGRC Number | 113981 |
| Genotype with FlyBase Link | w[1118]; P{w[+mW.hs]=GawB}Ten-m[NP6563] / TM6C, Sb[1] |
| Genotype | w1118; P{w+mW.hs=GawB}Ten-mNP6563 / TM6C, Sb1 |
| Break points/Insertion Site | 79E3 |
| Map Viewer |  |
| Related Genes | CG14460 CG32450 Ten-m |
| Original Number | 6563 |
| Chromosome | 3 |
| Comments | FlyBase Insertion: P{GawB}NP6563 NP line. Received from the National Institute of Genetics. |
| Balancer | TM6UW23-1 |
| Cluster id | 2034 |
| General Information | NP_lines |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Lethality | lethal |
| Embryonic Expression | epi subset (TU), prob anterior and posterior expression. |
| Larval GFP | psp, asp, oenocyte |
| Larval X-gal | sg, CNS, foregut |
| Adult GFP | internal |
| Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
| Last update | 2020-04-03 |
| Research papers using this strain [Please submit your publication] |
Otsuna H, Ito K. Systematic analysis of the visual projection neurons of Drosophila melanogaster. I. Lobula-specific pathways. J Comp Neurol (2006) 497(6) 928-58 [PubMed ID = 16802334] [RRC reference] Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
| Stock Request | |
| Library & Clone Information |
|---|
| Library Name / Clone Name | np / np46585_0912 |
| Strand | Minus |
| Insertion Point | 22325003 |
| Chromosome Band | 3L |
| Flanking Sequence | ggngggnnngnnaggggnnngnnngtnngtttttggnnnngannaacnggggtgcaagcc cnttttttgtanacttncggtaagcttcggctatcgacgggaccaccttatgttatttca tcatgACCTGCGTCTAACGAATTCTGACATAGTTTTACgatcgaagaatacataagagag aaccgtcgccaaagaacccattattgttggggtccgttttcaggaagggcaagccatccg acatgtcatcctcttcagaccaatcaaatccatgaagagcatccctgggcntaaaatcca acggaattgnggagttatcatgatgagctgccgagtcaatcgatacagncaactgncttt gacctttggtactactctcttccgatgatgatggccgcacttattctatgctggctcaat ggtagaggcatatcaagtctccactgaagccatcttattntgggnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnann |