| Strain Information | |
|---|---|
| DGRC Number | 114009 |
| Genotype with FlyBase Link | w[1118]; P{w[+mW.hs]=GawB}th[NP6632] / TM3, Sb[1] Ser[1] |
| Genotype | w1118; P{w+mW.hs=GawB}thNP6632 / TM3, Sb1 Ser1 |
| Break points/Insertion Site | 72D1 |
| Map Viewer |  |
| Related Genes | th Mbs |
| Original Number | 6632 |
| Chromosome | 3 |
| Comments | FlyBase Insertion: P{GawB}NP6632 NP line. Received from the National Institute of Genetics. |
| Balancer | TM3, Sb[1] Ser[1] |
| Cluster id | 1929 |
| General Information | NP_lines |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Embryonic Expression | mesoderm subset, pns subset |
| Larval GFP | tracheal terminal, fusion(?). internal tissue. |
| Larval X-gal | almost all PNS in the discs. sg, fb, CNS, |
| Adult GFP | none |
| Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
| Last update | 2020-04-03 |
| Research papers using this strain [Please submit your publication] |
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
| Library & Clone Information |
|---|
| Library Name / Clone Name | np / np01945_0711 |
| Strand | Plus |
| Insertion Point | 15996210 |
| Chromosome Band | 3L |
| Flanking Sequence | antcttgggtgcanagccctttttttgtatacttcggtaagcttcggctatcgacgggac caccttatgttatttcatcatgTGCACCGCATTTCCACCTCTCTCTCACTCTCTCTCACT CTGTCTGTCTGTCTCTCCTCCATTGTGGCGAGGAGGAAGGAGCAGCTGGAACTTTCACAA AGTCCACATATCAAAAAAGGTAGATTATTATGCCTTCNANTTCCgatcgaagaatacata agagagaaccgtcgccaaagaacccattattgttggggtccgttttcaggaagggcaagc catccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatccctgggcataa aatccaacggaattgtggagttatcatgatgagctgccgagtcaatcgatacagtcaact gtctttgacctttgttactactctcttccgatgatgatgtcgcacttattctatgctgtc tcaatgttagaggcatatcagtctccactgagcatctttntttttgnggnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn |
