| Strain Information | |
|---|---|
| DGRC Number | 114011 |
| Genotype with FlyBase Link | y[*] w[*]; P{w[+mW.hs]=GawB}Baldspot[NP6636] / TM6C, Sb[1] |
| Genotype | y* w*; P{w+mW.hs=GawB}BaldspotNP6636 / TM6C, Sb1 |
| Break points/Insertion Site | 73B5 |
| Map Viewer | ![]() |
| Related Genes | Galpha73B Baldspot snRNA:U12:73B |
| Original Number | 6636 |
| Chromosome | 3 |
| Comments | FlyBase Insertion: P{GawB}NP6636 NP line. Received from the National Institute of Genetics. |
| Balancer | TM6UW23-1 |
| Cluster id | 1938 |
| General Information | NP_lines |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Lethality | lethal |
| Embryonic Expression | muscle and epi? oenocyte |
| Larval GFP | fb |
| Larval X-gal | sg, fb, oenocyte |
| Adult GFP | tarsas, ant, abd. |
| Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
| Last update | 2020-04-03 |
| Research papers using this strain [Please submit your publication] |
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
| Library & Clone Information |
|---|
| Library Name / Clone Name | np / np01195_0711 |
| Strand | Plus |
| Insertion Point | 16610122 |
| Chromosome Band | 3L |
| Flanking Sequence | ancctctgggtgcactgcntttanntgtatacttcggtaagcttcggctatcgacgggac caccttatgttatttcatcatgGTTCCTGCTGAATCGATAAAGTTCTCGGTTAAATCAGC AAATGTCTGGGAAATACGTTTTTGCCTCTCCTCTCTTTCGTTCTCTCTCGCAGCATCGGA TGAGAAAAAAGGGGCGCAAAATAAGGAGGAAACCAAACCACCGCAAAACATCAACGAGTA CACGCACTCACACAGATATCACAGAAAACACGGTTACTATTTTCGAACGCTGATGTCTAT GAGGTAATTACATTTGCTCGCCGCCTCTTATCGCAGTATCAATTGGCTGgatcgaagaat acataagagagaaccgtcgccaaagaacccattattgttggggtccgttttcaggaaggg caagccatccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatccctggg cataaaatccaacggaattgtggagttatcatgatgagctgccgagtcaatcgatacagt caactgtctttgacctttgttactactctcttccgatgatgatgtcgcacttattctatg ctgtctcaatgttagaggcatatcagtctccctngntcnnntnnnnnnggggggnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnn |
| Image Files | ||
|---|---|---|
| Embryo |
|
|