| Strain Information | |
|---|---|
| DGRC Number | 114017 |
| Genotype with FlyBase Link | w[1118]; P{w[+mW.hs]=GawB}CG14709[NP6649] / TM3, Sb[1] Ser[1] |
| Genotype | w1118; P{w+mW.hs=GawB}CG14709NP6649 / TM3, Sb1 Ser1 |
| Break points/Insertion Site | 86E14 |
| Map Viewer | ![]() |
| Related Genes | BEST:CK01227 CG6790 G5{}1291 |
| Original Number | 6649 |
| Chromosome | 3 |
| Comments | FlyBase Insertion: P{GawB}NP6649 NP line. Received from the National Institute of Genetics. |
| Balancer | TM3, Sb[1] Ser[1] |
| Cluster id | 1440 |
| General Information | NP_lines |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Embryonic Expression | weak PNS (ch subset, TU), non PNS cells |
| Larval GFP | sg tr |
| Larval X-gal | sg, humeral, weak epi |
| Adult GFP | internal |
| Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
| Last update | 2026-08-04 |
| Research papers using this strain [Please submit your publication] |
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
| Stock Request | |
| Library & Clone Information |
|---|
| Library Name / Clone Name | np / np01335_0711 |
| Strand | Minus |
| Insertion Point | 7395009 |
| Chromosome Band | 3R |
| Flanking Sequence | anncttgggtgcaaacccnttttttgtatacttcggtaagcttcggctatcgacgggacc accttatgttatttcatcatgCCCACGACTATCTGCTCGCTCCGAAGGTCCGACTCGTTC TGACCCgatcgaagaatacataagagagaaccgtcgccaaagaacccattattgttgggg tccgttttcaggaagggcaagccatccgacatgtcattntcttcagaccaatcaaatcca tgaagagcatccctgggcataaaatccaacggaattgtggagttatcatgatgagctgcc gagtcaatcgatacagtcaactgtctttgacctttgttactactctcttccgatgatgat gtcgcacttattctatgctgtctcaatgttagaggcatatcagtctccactgagccatct tattattnggggnnnnnnntnntntnnntnnnntnaatnnnnngnangnatannnnnnnn nncacngngntnnaatnnnnnntnnnnnnnannnnnnnnnnnnaannnnnnnnnnnngnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnngnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nn |