Strain Information | |
---|---|
DGRC Number | 114116 |
Genotype with FlyBase Link | y[*] w[*] P{w[+mW.hs]=GawB}Sep4[NP7170] / FM7c |
Genotype | y* w* P{w+mW.hs=GawB}Sep4NP7170 / FM7c |
Break points/Insertion Site | 15A1 |
Map Viewer | |
Related Genes | CG4678 CG9699 Axs |
Original Number | 7170 |
Chromosome | 1 |
Comments | FlyBase Insertion: P{GawB}NP7170 NP line. Received from the National Institute of Genetics. |
Balancer | FM7c |
Cluster id | 395 |
General Information | NP_lines |
Genus | Drosophila |
Subgenus | Sophophora |
Species Group | melanogaster |
Species Subgroup | melanogaster |
Species | melanogaster |
Embryonic Expression | a small # of cells |
Larval X-gal | sg |
Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
Last update | 2020-10-29 |
Research papers using this strain [Please submit your publication] |
Grice SJ, Liu JL, Webber C. Synergistic interactions between Drosophila orthologues of genes spanned by de novo human CNVs support multiple-hit models of autism. PLoS Genet (2015) 11(3) e1004998 [PubMed ID = 25816101] [RRC reference] Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
Stock Request |
Library & Clone Information |
---|
Library Name / Clone Name | np / np25095_0807 |
Strand | Plus |
Insertion Point | 16425837 |
Chromosome Band | X |
Flanking Sequence | ggggnnantgnntgttngtttttttngnnnngattcacagngggtnnannnncncgtant ttnggncnnncggtaagaccncggctattngacgggnaccaccttttgttatttcatcat gGTGCAGCTGCTTCACCTTGACCTACACGACCACAAGTAACAGTGAGATGCACAATACAC TCACACACACACACACAGCGCCAAATCACCGCTCTTACACACACGAAAAATAATAATAAA AAAAAGGCTCACGCACTTTGTTATTAACTATTTCCGTTGTTTTGGTTTCCTCTTTTTTTT TGGGGCAAAACTGTATGAAATTTCACCGAAAAAAAAATNGNCGGGGNAAATATTCCAAAC TTNTANGGGAATNTTATTTACAATAACAAATATGGTTTTNTGAGNGGAGTTTTNAAACAT ACACTTTCCGNGCGCTTTTACTGATGCTTTTTCACCGCCGTCGCGTCGAgatcgaanaat acataagagagaaccgncgccaaanaacccattnttgtnggggnccgttttcagganggg caagccatccgacatgtcatccttttnagaccaatcaaatccatgaagagcatccctggg cataaaatccaacggaattggggagttatcatgatgagctgccgagtcaatcgatacaga caactgncttngacctttggtactactctcttccgaagatgatggcgcacttattctatg ctgtctcaatgttagnggcatatcagnctccactngcannnnnnnnnnnnggggnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnggnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnn |