| Strain Information | |
|---|---|
| DGRC Number | 114116 |
| Genotype with FlyBase Link | y[*] w[*] P{w[+mW.hs]=GawB}Sep4[NP7170] / FM7c |
| Genotype | y* w* P{w+mW.hs=GawB}Sep4NP7170 / FM7c |
| Break points/Insertion Site | 15A1 |
| Map Viewer |  |
| Related Genes | CG4678 CG9699 Axs |
| Original Number | 7170 |
| Chromosome | 1 |
| Comments | FlyBase Insertion: P{GawB}NP7170 NP line. Received from the National Institute of Genetics. |
| Balancer | FM7c |
| Cluster id | 395 |
| General Information | NP_lines |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Embryonic Expression | a small # of cells |
| Larval X-gal | sg |
| Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
| Last update | 2020-10-29 |
| Research papers using this strain [Please submit your publication] |
Grice SJ, Liu JL, Webber C. Synergistic interactions between Drosophila orthologues of genes spanned by de novo human CNVs support multiple-hit models of autism. PLoS Genet (2015) 11(3) e1004998 [PubMed ID = 25816101] [RRC reference] Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
| Library & Clone Information |
|---|
| Library Name / Clone Name | np / np25095_0807 |
| Strand | Plus |
| Insertion Point | 16425837 |
| Chromosome Band | X |
| Flanking Sequence | ggggnnantgnntgttngtttttttngnnnngattcacagngggtnnannnncncgtant ttnggncnnncggtaagaccncggctattngacgggnaccaccttttgttatttcatcat gGTGCAGCTGCTTCACCTTGACCTACACGACCACAAGTAACAGTGAGATGCACAATACAC TCACACACACACACACAGCGCCAAATCACCGCTCTTACACACACGAAAAATAATAATAAA AAAAAGGCTCACGCACTTTGTTATTAACTATTTCCGTTGTTTTGGTTTCCTCTTTTTTTT TGGGGCAAAACTGTATGAAATTTCACCGAAAAAAAAATNGNCGGGGNAAATATTCCAAAC TTNTANGGGAATNTTATTTACAATAACAAATATGGTTTTNTGAGNGGAGTTTTNAAACAT ACACTTTCCGNGCGCTTTTACTGATGCTTTTTCACCGCCGTCGCGTCGAgatcgaanaat acataagagagaaccgncgccaaanaacccattnttgtnggggnccgttttcagganggg caagccatccgacatgtcatccttttnagaccaatcaaatccatgaagagcatccctggg cataaaatccaacggaattggggagttatcatgatgagctgccgagtcaatcgatacaga caactgncttngacctttggtactactctcttccgaagatgatggcgcacttattctatg ctgtctcaatgttagnggcatatcagnctccactngcannnnnnnnnnnnggggnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnggnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnn |