Detailed Information [140078]
 

Strain Information
DGRC Number 140078
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=FRT(w[hs])}2A P{ry[+t7.2]=neoFRT}82B PBac{SAstopDsRed}LL00378 P{y[+t7.7] ry[+t7.2]=Car20y}96E / TM3, Sb[1]
Genotype y* w*; P{w+mW.hs=FRT(whs)}2A P{ry+t7.2=neoFRT}82B PBac{SAstopDsRed}LL00378 P{y+t7.7 ry+t7.2=Car20y}96E / TM3, Sb1
Break points/Insertion Site 92E7
Related Genes CG34118
Received Date 19 October 2007
Original Number LL00378
Chromosome 3
Original Source Liqun Luo, Stanford University
Original Comments
Location: 3R:16227265(-)
Cytological Band: 92E7
Gene Symbol-1: CG34118
CG Number-1: CG34118
FlyBase ID-1: FBgn0083954
Insertion Type-1: Putative Promoter
Gene Symbol-2:
CG Number-2:
FlyBase ID-2:
Insertion Type-2:
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) Because second chromosome was never actively selected against, a small percentage of homozygous cn bw flies resulting in white eyes can be present in the population.
2) All third chromosome flies should be yellow[1] due to the insertion at 96E.
3) A small percentage of early insertions (lower LL number) were balanced with TM3, Sb[1] instead of TM6, Tb[1].
4) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Kallijarvi J, Stratoulias V, Virtanen K, Hietakangas V, Heino TI, Saarma M.
Characterization of Drosophila GDNF receptor-like and evidence for its evolutionarily conserved interaction with neural cell adhesion molecule (NCAM)/FasII.
PLoS One (2012) 7(12) e51997 [PubMed ID = 23284846] [RRC reference]
Stock Request

Library & Clone Information
Strand Minus
Insertion Point 16227265
Chromosome Band 3R
Flanking Sequence
AGCCATGCGTCATTTTACGCAGACTATCTTTCTAGGGTTAAAGAAGAATAGAAATCCAAT
TGTTTAATGTGCACATGCATTTTTGATGTAATTGGCAATTTTAAACTTTGCATGCCCCGA
ACGGAAGTCGCCGGCGATGCGGCTTCGGTTGCGGCGGTTAGAAACTCGAATTAACCATTG
TGGGAACACTAGAACTAGCTAGTTCTAGAGCGGCCGCCACCGCGGTGGAGCTCCAATTCG
CCCTATAGTGAGTCGTATTACGTTATCTAGTTAGGCGCGCCTGTGGGACGGAAGAACAGA
TGAATTAGATATCTATAACAAGAAAATATATATATAATAAGTTATCACGTAAGTAGAACA
TGAAATAACAATATAATTATCGTATGAGTTAAATCTTAAAAGTCACGTAAAAGATAATCA
TGCGTCATTTTGACTCACGCGGTCGTTATATTTCAAAATCAGTGACACTTACCGCATTGA
CAAGTCACGCCTCACTGAATCTAGTCTTATAATTGACA
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE