Detailed Information [140188]
 

Strain Information
DGRC Number 140188
Genotype with FlyBase Link y[*] w[*]; P{ry[+t7.2]=neoFRT}40A P{w[+mW.hs]=FRT(w[hs])}G13 cn[1] PBac{SAstopDsRed}LL00908 bw[1] / CyO, S[*] bw[1]
Genotype y* w*; P{ry+t7.2=neoFRT}40A P{w+mW.hs=FRT(whs)}G13 cn1 PBac{SAstopDsRed}LL00908 bw1 / CyO, S* bw1
Break points/Insertion Site 50E6
Related Genes CG8531, Hsc70-5 (CG8542)
Received Date 19 October 2007
Original Number LL00908
Chromosome 2
Original Source Liqun Luo, Stanford University
Original Comments
Location: 2R:10143894(+)
Cytological Band: 50E6
Gene Symbol-1: CG8531
CG Number-1: CG8531
FlyBase ID-1: FBgn0033918
Insertion Type-1: Putative Promoter
Gene Symbol-2: Hsc70-5
CG Number-2: CG8542
FlyBase ID-2: FBgn0001220
Insertion Type-2: Putative Promoter.
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) The combination of cn[1] bw[1] / CyO, S[*] bw[1] results in white eyes regardless of w[+] transgenes - therefore all flies should have white eyes when in stock - cross out to see red eye.
2) Third chromosome was never actively selected against, so y[+] flies may exist.
3) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]		 Liaw GJ, Chiang CS.
Inactive Tlk associating with Tak1 increases p38 MAPK activity to prolong the G2 phase.
Sci Rep (2019) 9(1) 1885 [PubMed ID = 30760733] [RRC reference]
Stock Request

Library & Clone Information
Strand Plus
Insertion Point 10143894
Chromosome Band 2R
Flanking Sequence 
actatctttctagggttaaCCTACATATTTTTTACCACTGGTSYCKMWRWTGTAGTGAGA
CCGTACATCCGCAGTATGACCGTATYTCAAAACAAAACCCAGTTGGAGCAAACCATCGTC
AACTATCGGAACATTCAACACATGTATAGTCATTGCGTAAAAGTACCCAAAAATTTcgaa
ttaaccattgtgggaacactagaac
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE