| Strain Information | |
|---|---|
| DGRC Number | 140188 |
| Genotype with FlyBase Link | y[*] w[*]; P{ry[+t7.2]=neoFRT}40A P{w[+mW.hs]=FRT(w[hs])}G13 cn[1] PBac{SAstopDsRed}LL00908 bw[1] / CyO, S[*] bw[1] |
| Genotype | y* w*; P{ry+t7.2=neoFRT}40A P{w+mW.hs=FRT(whs)}G13 cn1 PBac{SAstopDsRed}LL00908 bw1 / CyO, S* bw1 |
| Break points/Insertion Site | 50E6 |
| Related Genes | CG8531, Hsc70-5 (CG8542) |
| Received Date | 19 October 2007 |
| Original Number | LL00908 |
| Chromosome | 2 |
| Original Source | Liqun Luo, Stanford University |
| Original Comments | Location: 2R:10143894(+) Cytological Band: 50E6 Gene Symbol-1: CG8531 CG Number-1: CG8531 FlyBase ID-1: FBgn0033918 Insertion Type-1: Putative Promoter Gene Symbol-2: Hsc70-5 CG Number-2: CG8542 FlyBase ID-2: FBgn0001220 Insertion Type-2: Putative Promoter. Location coordinates are based on the Drosophila Genome release 5.0. IMPORTANT NOTES: Oren Schuldiner (Weizmann Institute of Science) |
| General Information | MARCM |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Reference | Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L. piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning. Dev Cell (2008) 14(2) 227-38 [RRC reference] |
| Last update | 2020-04-03 |
| Research papers using this strain [Please submit your publication] |
Liaw GJ, Chiang CS. Inactive Tlk associating with Tak1 increases p38 MAPK activity to prolong the G2 phase. Sci Rep (2019) 9(1) 1885 [PubMed ID = 30760733] [RRC reference] |
| Library & Clone Information |
|---|
| Strand | Plus |
| Insertion Point | 10143894 |
| Chromosome Band | 2R |
| Flanking Sequence | actatctttctagggttaaCCTACATATTTTTTACCACTGGTSYCKMWRWTGTAGTGAGA CCGTACATCCGCAGTATGACCGTATYTCAAAACAAAACCCAGTTGGAGCAAACCATCGTC AACTATCGGAACATTCAACACATGTATAGTCATTGCGTAAAAGTACCCAAAAATTTcgaa ttaaccattgtgggaacactagaac |
| Sequence Comment | Location coordinates are based on the Drosophila Genome release 5.0. |