Detailed Information [140688]
 

Strain Information
DGRC Number 140688
Genotype with FlyBase Link y[*] w[*]; P{ry[+t7.2]=neoFRT}40A P{w[+mW.hs]=FRT(w[hs])}G13 cn[1] PBac{SAstopDsRed}LL02791 bw[1] / CyO, S[*] bw[1]
Genotype y* w*; P{ry+t7.2=neoFRT}40A P{w+mW.hs=FRT(whs)}G13 cn1 PBac{SAstopDsRed}LL02791 bw1 / CyO, S* bw1
Break points/Insertion Site 57A6
Related Genes CG13434, bl (CG13425)
Received Date 25 October 2007
Original Number LL02791
Chromosome 2
Original Source Liqun Luo, Stanford University
Original Comments
Location: ~2R:16474407(+)
Cytological Band: 57A6
Gene Symbol-1: CG13434
CG Number-1: CG13434
FlyBase ID-1: FBgn0034523
Insertion Type-1: CDS
Gene Symbol-2: bl
CG Number-2: CG13425
FlyBase ID-2: FBgn0015907
Insertion Type-2: Putative Promoter.
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) The combination of cn[1] bw[1] / CyO, S[*] bw[1] results in white eyes regardless of w[+] transgenes - therefore all flies should have white eyes when in stock - cross out to see red eye.
2) Third chromosome was never actively selected against, so y[+] flies may exist.
3) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Blattner AC, Aguilar-Rodriguez J, Kranzlin M, Wagner A, Lehner CF.
Drosophila Nnf1 paralogs are partially redundant for somatic and germ line kinetochore function.
Chromosoma (2017) 126(1) 145-163 [PubMed ID = 26892014] [RRC reference]
Stock Request

Library & Clone Information
Strand Plus
Insertion Point 16474407
Chromosome Band 2R
Flanking Sequence
AAAAAAGAATGCATGCGTCATTTTAACTCACAACGAGTCAAAAAAAGGTGAATGAAGCAA
TGCGGAATATTAATCACCGCTTGAGGTCATTTTGACTCACGCGGTCAACGAGTCGAATGT
GCATTTGGGCATTTGAAACCCCGGTGGGGGGATTAGATACGTAATACGACAAACTATGGG
CGAATGGAGCTCCACCGCGGTGGCGGCCGCTATTGAAATAGCTAGttctagtgttcccac
aatggtaaattcgaGAACAACCTTGGTCATCAGAAGCGAGTGCGATCTACGATGCTATCG
GTGTCCAGAAGGAATGCTCGTGCTCCTGGTAAATGGCATCCCACACTAGCAGATCTGCGC
AGCTAGATTTAAACGATAGTtaaccctagaaagatagtctgcgtaaaaTTGACGCATGCA
TTCTTGAAATATTGCTCTCTCTTTCTAAATAGCGCGAATGCATCACTGTGCAATTAGGAA
ATT
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE