Detailed Information [140691]
Strain Information
DGRC Number 140691
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=FRT(w[hs])}2A P{ry[+t7.2]=neoFRT}82B PBac{SAstopDsRed}LL02849 P{y[+t7.7] ry[+t7.2]=Car20y}96E / TM6B, Tb[1]
Genotype y* w*; P{w+mW.hs=FRT(whs)}2A P{ry+t7.2=neoFRT}82B PBac{SAstopDsRed}LL02849 P{y+t7.7 ry+t7.2=Car20y}96E / TM6B, Tb1
Break points/Insertion Site 94A1
Related Genes CG6455, mRpL35 (CG13410)
Received Date 25 October 2007
Original Number LL02849
Chromosome 3
Original Source Liqun Luo, Stanford University
Original Comments
Location: 3R:17848395(+)
Cytological Band: 94A1
Gene Symbol-1: CG6455
CG Number-1: CG6455
FlyBase ID-1: FBgn0019960
Insertion Type-1: Intron
Gene Symbol-2: mRpL35
CG Number-2: CG13410
FlyBase ID-2: FBgn0038923
Insertion Type-2: Putative Promoter.
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) Because second chromosome was never actively selected against, a small percentage of homozygous cn bw flies resulting in white eyes can be present in the population.
2) All third chromosome flies should be yellow[1] due to the insertion at 96E.
3) A small percentage of early insertions (lower LL number) were balanced with TM3, Sb[1] instead of TM6, Tb[1].
4) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Tsai PI, Lin CH, Hsieh CH, Papakyrikos AM, Kim MJ, Napolioni V, Schoor C, Couthouis J, Wu RM, Wszolek ZK, Winter D, Greicius MD, Ross OA, Wang X.
PINK1 Phosphorylates MIC60/Mitofilin to Control Structural Plasticity of Mitochondrial Crista Junctions.
Mol Cell (2018) 69(5) 744-756.e6 [PubMed ID = 29456190] [RRC reference]

Tsai PI, Papakyrikos AM, Hsieh CH, Wang X.
Drosophila MIC60/mitofilin conducts dual roles in mitochondrial motility and crista structure.
Mol Biol Cell (2017) 28(24) 3471-3479 [PubMed ID = 28904209] [RRC reference]

Library & Clone Information
Strand Plus
Insertion Point 17848395
Chromosome Band 3R
Flanking Sequence
cagactatttttctagggttaaGGAAATTGGCGAGCCCGTTAATACCCCCGCGCCCTTGG
TCAACTGGAATTTTGGAGCTTTTCGCCCAATTCCTGGGCTTGGTAGATGACATAACCAGC
GCCTCTTGTTGTATTTTCGCCAACCGCTTGTTTGTGGGCGCGCGGGGGTGTGGGGCAACG
TGACGATcgaattaaccattgtgggaacactagaac
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE