Detailed Information [140936]
 

Strain Information
DGRC Number 140936
Genotype with FlyBase Link y[*] w[*]; PBac{SAstopDsRed}LL05566 P{ry[+t7.2]=neoFRT}40A P{w[+mW.hs]=FRT(w[hs])}G13 cn[1] bw[1] / CyO, S[*] bw[1]
Genotype y* w*; PBac{SAstopDsRed}LL05566 P{ry+t7.2=neoFRT}40A P{w+mW.hs=FRT(whs)}G13 cn1 bw1 / CyO, S* bw1
Break points/Insertion Site 22B2
Related Genes Gr22e (CG31936)
Received Date 25 October 2007
Original Number LL05566
Chromosome 2
Original Source Liqun Luo, Stanford University
Original Comments
Location: 2L:1784880(-)
Cytological Band: 22B2
Gene Symbol-1: Gr22e
CG Number-1: CG31936
FlyBase ID-1: FBgn0045497
Insertion Type-1: CDS
Gene Symbol-2:
CG Number-2:
FlyBase ID-2:
Insertion Type-2:
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) The combination of cn[1] bw[1] / CyO, S[*] bw[1] results in white eyes regardless of w[+] transgenes - therefore all flies should have white eyes when in stock - cross out to see red eye.
2) Third chromosome was never actively selected against, so y[+] flies may exist.
3) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]		 Aryal B, Dhakal S, Shrestha B, Lee Y.
Molecular and neuronal mechanisms for amino acid taste perception in the Drosophila labellum.
Curr Biol (2022) 32(6) 1376-1386.e4 [PubMed ID = 35176225] [RRC reference]

Shrestha B, Nhuchhen Pradhan R, Nath DK, Lee Y.
Cellular and molecular basis of IR3535 perception in Drosophila.
Pest Manag Sci (2022) 78(2) 793-802 [PubMed ID = 34708523] [RRC reference]

Dhakal S, Sang J, Aryal B, Lee Y.
Ionotropic receptors mediate nitrogenous waste avoidance in Drosophila melanogaster.
Commun Biol (2021) 4(1) 1281 [PubMed ID = 34773080] [RRC reference]
Stock Request

Library & Clone Information
Strand Minus
Insertion Point 1784880
Chromosome Band 2L
Flanking Sequence 
tttacgcagactatctttctagggTTAAGAAGAAGTAGATGCCCAGCACGTTGGCGATAA
GAAAGCTGACCATCACCATGACCATTTGATAATCATAGATGGATGCCAGACGCTGGCCGA
GATCCAATAGGCGATGGTACAGATAGAGCAAAAGGTCCATCCGCTCAGACTCAACAGTTT
CCCCAATCGCCATTTTGTTAACTAGTTTGAGAAGCTCCCTATTTACAATCCACACATATC
GGTAGACAAAGACCACGGCCAGGTGAAAGTGTGAGGCTCCCAGGAGAACTGCCAGCAACA
TCAAACACAAACTGACGAGTCCAATGAAAAACTGTGCACTGTAGTTCGGTGACATGCCCA
GTTCCAGCACCAGCATGGATACTAGTTCCAGGACCACAGAGAAGCCTTTGTACAGGACAA
ACCTATCGAAttaaccattgtgggaacactagaac
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE