Detailed Information [141749]
Strain Information
DGRC Number 141749
Genotype with FlyBase Link y[*] w[*]; P{ry[+t7.2]=neoFRT}40A P{w[+mW.hs]=FRT(w[hs])}G13 cn[1] PBac{SAstopDsRed}LL06026 bw[1] / CyO, S[*] bw[1]
Genotype y* w*; P{ry+t7.2=neoFRT}40A P{w+mW.hs=FRT(whs)}G13 cn1 PBac{SAstopDsRed}LL06026 bw1 / CyO, S* bw1
Break points/Insertion Site 48C5
Related Genes Ef1alpha48D (CG8280)
Received Date 19 November 2007
Original Number LL06026
Chromosome 2
Original Source Liqun Luo, Stanford University
Original Comments
Location: 2R:7780071(-)
Cytological Band: 48C5
Gene Symbol-1: Ef1alpha48D
CG Number-1: CG8280
FlyBase ID-1: FBgn0000556
Insertion Type-1: Intron
Gene Symbol-2:
CG Number-2:
FlyBase ID-2:
Insertion Type-2:
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) The combination of cn[1] bw[1] / CyO, S[*] bw[1] results in white eyes regardless of w[+] transgenes - therefore all flies should have white eyes when in stock - cross out to see red eye.
2) Third chromosome was never actively selected against, so y[+] flies may exist.
3) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Liaw GJ, Chiang CS.
Inactive Tlk associating with Tak1 increases p38 MAPK activity to prolong the G2 phase.
Sci Rep (2019) 9(1) 1885 [PubMed ID = 30760733] [RRC reference]

Library & Clone Information
Strand Minus
Insertion Point 7780071
Chromosome Band 2R
Flanking Sequence
tttacgcagactatctttctagggTTAATGAGCACATCTGGTGGATGACCTCTGTGTCCG
GCGTGGGCGTGGCAAAGTAATTACACACTAAGTGCACCATATTGCAGGGCGAAAATGCGG
CCGGAAAAGCCGGAAAATTATTTTGAGAATGCTGGGAACTTTAACTGGGAACGCCAGTTA
AAATTTTTGCCTTTGCAGACTTGCCACGTGTTTGCTTCTATGGCCACCTTTCACTTTGGA
AAACCGCAGTTAGAGGTTATCTCCGGGTTTATTACACACACACAGGAAAAACACTGGAAA
TATGCACAAATTCGGCATCTCAGCTGCATATTTGTTTATAAATTGTTTTCTGGCTGCAGT
CCCGTTGCAGAAATCACTTAATTATAGCCTCGCAGGTAAAACTTACTCTCGAAttaacca
ttgtgggaacactagaac
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE