Detailed Information [141848]
 

Strain Information
DGRC Number 141848
Genotype with FlyBase Link y[*] w[*]; PBac{SAstopDsRed}LL06666 P{ry[+t7.2]=neoFRT}40A P{w[+mW.hs]=FRT(w[hs])}G13 cn[1] bw[1] / CyO, S[*] bw[1]
Genotype y* w*; PBac{SAstopDsRed}LL06666 P{ry+t7.2=neoFRT}40A P{w+mW.hs=FRT(whs)}G13 cn1 bw1 / CyO, S* bw1
Break points/Insertion Site 21E2
Related Genes Ptth (CG13687), Pph13 (CG2819)
Received Date 19 November 2007
Original Number LL06666
Chromosome 2
Original Source Liqun Luo, Stanford University
Original Comments
Location: 2L:576823(+)
Cytological Band: 21E2
Gene Symbol-1: Ptth
CG Number-1: CG13687
FlyBase ID-1:
Insertion Type-1: Putative Promoter
Gene Symbol-2: Pph13
CG Number-2: CG2819
FlyBase ID-2:
Insertion Type-2: Putative Promoter.
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) The combination of cn[1] bw[1] / CyO, S[*] bw[1] results in white eyes regardless of w[+] transgenes - therefore all flies should have white eyes when in stock - cross out to see red eye.
2) Third chromosome was never actively selected against, so y[+] flies may exist.
3) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]		 Deliu LP, Turingan M, Jadir D, Lee B, Ghosh A, Grewal SS.
Serotonergic neuron ribosomal proteins regulate the neuroendocrine control of Drosophila development.
PLoS Genet (2022) 18(9) e1010371 [PubMed ID = 36048889] [RRC reference]
Stock Request

Library & Clone Information
Strand Plus
Insertion Point 576823
Chromosome Band 2L
Flanking Sequence 
tttacgcagactatctttctagggTTAAGGCCTCAAGTGCCGGCAGAGGTGGAGAACTTT
GGGCGGTGGGAGTAGCCAAAAGAAGCCCACTGACCCAGACATGTGTGCAGAGGCAAAGGG
CAATCCGATCTCCTCCCATCGAAttaaccattgtgggaacactagaac
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE