Detailed Information [141919]
 

Strain Information
DGRC Number 141919
Genotype with FlyBase Link y[*] w[*]; P{ry[+t7.2]=neoFRT}40A P{w[+mW.hs]=FRT(w[hs])}G13 PBac{SAstopDsRed}LL06826 cn[1] bw[1] / CyO, S[*] bw[1]
Genotype y* w*; P{ry+t7.2=neoFRT}40A P{w+mW.hs=FRT(whs)}G13 PBac{SAstopDsRed}LL06826 cn1 bw1 / CyO, S* bw1
Break points/Insertion Site 43D1
Related Genes CG1603 (CG1603)
Received Date 11 December 2008
Original Number LL06826
Chromosome 2
Original Source Liqun Luo, Stanford University
Original Comments
Location: 2R:3403125(-)
Cytological Band: 43D1
Gene Symbol-1: CG1603
CG Number-1: CG1603
FlyBase ID-1: FBgn0033185
Insertion Type-1: Intron
Gene Symbol-2:
CG Number-2:
FlyBase ID-2:
Insertion Type-2:
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) The combination of cn[1] bw[1] / CyO, S[*] bw[1] results in white eyes regardless of w[+] transgenes - therefore all flies should have white eyes when in stock - cross out to see red eye.
2) Third chromosome was never actively selected against, so y[+] flies may exist.
3) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]		 Zhang F, Lee A, Freitas AV, Herb JT, Wang ZH, Gupta S, Chen Z, Xu H.
A transcription network underlies the dual genomic coordination of mitochondrial biogenesis.
Elife (2024) 13 [PubMed ID = 39727307] [RRC reference]
Stock Request

Library & Clone Information
Strand Minus
Insertion Point 3403125
Chromosome Band 2R
Flanking Sequence 
tttacgcagactatctttctagggTTAAGCTGAAATTCATTCCACTTAACGGCGTCATTC
AGTTCAAAGTTTCGTTTATTCGGAGCAATCCCCGTGTGCTGCATTTGATCCAAGCGTACA
AAGAGCATCCCTGCCTGTGGAACCCTTCCGATGAACACTACCAGGACGAGCCTGCACGAA
GCATGGCCTACGAGGCGATAATGGAACGCATGGACCGCAAGGCCAATGTTCTCTTCACCG
TGGAAGAACTGAAGAAAACGCTCGAAttaaccattgtgggaacactagaac
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE