Detailed Information [141994]
 

Strain Information
DGRC Number 141994
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=FRT(w[hs])}2A PBac{SAstopDsRed}LL07221 P{ry[+t7.2]=neoFRT}82B P{y[+t7.7] ry[+t7.2]=Car20y}96E / TM6B, Tb[1]
Genotype y* w*; P{w+mW.hs=FRT(whs)}2A PBac{SAstopDsRed}LL07221 P{ry+t7.2=neoFRT}82B P{y+t7.7 ry+t7.2=Car20y}96E / TM6B, Tb1
Break points/Insertion Site 80D1
Related Genes CkIIalpha (CG17520)
Received Date 11 December 2008
Original Number LL07221
Chromosome 3
Original Source Liqun Luo, Stanford University
Original Comments
Location: 3L:23093743(-)
Cytological Band: 80D1
Gene Symbol-1: CkIIalpha
CG Number-1: CG17520
FlyBase ID-1: FBgn0000258
Insertion Type-1: Intron
Gene Symbol-2:
CG Number-2:
FlyBase ID-2:
Insertion Type-2:
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) Because second chromosome was never actively selected against, a small percentage of homozygous cn bw flies resulting in white eyes can be present in the population.
2) All third chromosome flies should be yellow[1] due to the insertion at 96E.
3) A small percentage of early insertions (lower LL number) were balanced with TM3, Sb[1] instead of TM6, Tb[1].
4) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]		 Bulat V, Rast M, Pielage J.
Presynaptic CK2 promotes synapse organization and stability by targeting Ankyrin2.
J Cell Biol (2014) 204(1) 77-94 [PubMed ID = 24395637] [RRC reference]
Stock Request

Library & Clone Information
Strand Minus
Insertion Point 23093743
Chromosome Band 3L
Flanking Sequence 
tttacgcagactatctttctagggTTAATTAAAATAATTTAGGAAGAATGTATTATATTA
AAAAGCTGCAAAACAAATAATGTAAGAAGTACAAACATGTGGGTTTCTTAATCGTGTGCA
CTTAATTAATATTTTTCAGCATGAATTTATTAAGTTATAGAGCAACCAAAAGAGTTTAAT
CGAAttaaccattgtgggaacactagaac
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE