Detailed Information [142008]
 

Strain Information
DGRC Number 142008
Genotype with FlyBase Link y[*] w[*]; PBac{SAstopDsRed}LL07287 P{ry[+t7.2]=neoFRT}40A P{w[+mW.hs]=FRT(w[hs])}G13 cn[1] bw[1] / CyO, S[*] bw[1]
Genotype y* w*; PBac{SAstopDsRed}LL07287 P{ry+t7.2=neoFRT}40A P{w+mW.hs=FRT(whs)}G13 cn1 bw1 / CyO, S* bw1
Break points/Insertion Site 31E2
Related Genes CG5198 (CG5198), CG5337 (CG5337)
Received Date 11 December 2008
Original Number LL07287
Chromosome 2
Original Source Liqun Luo, Stanford University
Original Comments
Location: 2L:10436038(+)
Cytological Band: 31E2
Gene Symbol-1: CG5198
CG Number-1: CG5198
FlyBase ID-1: FBgn0032250
Insertion Type-1: 5' UTR
Gene Symbol-2: CG5337
CG Number-2: CG5337
FlyBase ID-2: FBgn0032249
Insertion Type-2: Putative Promoter
Location coordinates are based on the Drosophila Genome release 5.0.

IMPORTANT NOTES:
1) The combination of cn[1] bw[1] / CyO, S[*] bw[1] results in white eyes regardless of w[+] transgenes - therefore all flies should have white eyes when in stock - cross out to see red eye.
2) Third chromosome was never actively selected against, so y[+] flies may exist.
3) No FRT on mutator vector - thus NOT compatible with Harvard collection to create deletions.

Oren Schuldiner (Weizmann Institute of Science)
General Information MARCM
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Reference Schuldiner O, Berdnik D, Levy JM, Wu JS, Luginbuhl D, Gontang AC, Luo L.
piggyBac-based mosaic screen identifies a postmitotic function for cohesin in regulating developmental axon pruning.
Dev Cell (2008) 14(2) 227-38 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]		 Geiger JA, Carvalho L, Campos I, Santos AC, Jacinto A.
Hole-in-one mutant phenotypes link EGFR/ERK signaling to epithelial tissue repair in Drosophila.
PLoS One (2011) 6(11) e28349 [PubMed ID = 22140578] [RRC reference]
Stock Request

Library & Clone Information
Strand Plus
Insertion Point 10436038
Chromosome Band 2L
Flanking Sequence 
tttacgcagactatctttctagggTTAAAAATATTGACATTGCATTTAGTTTTGTCTTGA
GTTCTTGATAAAATGGCGAGCAAAAGAAAGCACCAAGCATCCCAGAAAGTGAAAGAGGAA
TCCTTCAAGAAACACACGCTTGACTCCGATGAAGAGGATTCTGACGACTACGAAAGGTAA
TGCTTAAAATGTGCAAACAATTGATTGTTTTGATTTCGGCACTTTTTGTTTGCAGGGAAT
ACCTCAATGATAGCGACATTGAGGGCGGCGAGGAGGGCGTGGCAAAAGTGGAAGACGATG
TGAAGGTAACACCCTTCAATATGAAGGAAGAACTGGAGGAGGGACACTTCGAAttaacca
ttgtgggaacactagaac
Sequence Comment Location coordinates are based on the Drosophila Genome release 5.0.

CLOSE