Detailed Information [200175]
 

Strain Information
DGRC Number 200175
Genotype with FlyBase Link y[1] w[67c23] P{w[+mC]=GSV1}GS1189 / C(1)DX, y[1] w[1] f[1]
Genotype y1 w67c23 P{w+mC=GSV1}GS1189 / C(1)DX, y1 w1 f1
Break points/Insertion Site 19F2
Map Viewer
Related Genes CG1704(CT4818)
Received Date 12/20/02
Original Number 1189
Comments Received from Tokyo Metropolitan University.
Original Comments Vector: GSV1
Location (tagged genes): Exon
Function / Process (tagged genes): structural protein
General Information GS_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Reference Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [RRC reference]
Last update 2022-02-15
Research papers using this strain
[Please submit your publication]
Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [PubMed ID = 9927464] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name GSV1
Insertion Point 21129722 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Flanking Sequence
TGGCAAGGTGGAAAAGCTCGTCCACGGTGTCCGTATCGCTGTCCGACATGTCAAAAAAAA
AAAAAATCTGCTGAGCTTATAAACTAAATGACAATTAAAGTGGGGAATCTAAGATTTCTG
TATGTTTAGGTAGTTGCCCTCCAGTATGTGCTTCTGCTCGTTCTCGATCTTCTCCAGCGC
GGTCAAACTGTTGAAGCTAACGAAACCGTAGCCCTTCGAGCACCCCGTTCGCTTGTCGAA
GATCACGTTGGCGGA
Sequence Comment X:21129423..21129722dmel-X-chromosome-r4.1.1.fasta. 5' upstream sequence from genome annotation release 4.1.1. This is not raw data.

Library Name / Clone Name GSV1
Insertion Point 21129722 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Flanking Sequence
GGCCCACTGTCCACGGTAGATTGCCCACGAAAATGCGGTGCACTGATTTTCCGACTTTTG
CTACAGCTGCGGCGGTGGCCATGGACTCGGTTTTGCTAAATGAGGTGTGAATTCGAATTA
AATATGGTTTTCTGCTTCTTCCAGCCAAGGCGATCTGGATTCCCGGCGACTCCTTACCAG
TTGCGTTGCGTAAATACTGCTGCGTTTCTGTTTCACGTCAACTTGCTGTTTTTGTCGACA
GAGAGACATAACCTCAAAGAGGCAGCTAACAGCGCAGTGCTATTACCCTACATGTCGGAG
Sequence Comment X:21129722..21130021dmel-X-chromosome-r4.1.1.fasta. 3' downstream sequence from genome annotation release 4.1.1. This is not raw data.

CLOSE