Detailed Information [200424]
Strain Information
DGRC Number 200424
Genotype with FlyBase Link y[1] w[67c23]; P{w[+mC]=GSV1}eIF-3p66[GS3028] / TM6C, Sb[1] Tb[1]
Genotype y1 w67c23; P{w+mC=GSV1}eIF-3p66GS3028 / TM6C, Sb1 Tb1
Break points/Insertion Site 95B1
Map Viewer
Related Genes CG10161(CT28571)
Received Date 1/28/03
Original Number 3028
Comments Received from Tokyo Metropolitan University.
Original Comments Vector: GSV1
Location (tagged genes): 5'UTR
Function / Process (tagged genes): translation factor
General Information GS_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Reference Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [RRC reference]
Last update 2025-04-25
Research papers using this strain
[Please submit your publication]
Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [PubMed ID = 9927464] [RRC reference]

Library & Clone Information
Library Name / Clone Name GSV1
Insertion Point 19505870 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Flanking Sequence
TTCATTTAACAATACATTTTTTTATTAAAAAATATTTTTTGCATTTTCTTTGTAATTAAA
TCGTAAAATCAGGTTCTGAAAAATGAATAGTTCGAATTTTTAGTTTTCCCGCCCAGCAGT
GGCGCCATCTATGACAGCATGCTGCCAGACCTTTGAACATTCGCTACGATTTTAGTATTT
TTCTTTGGCGGTGGTATATTTCAACGCGACAACGGTCCCACTCAACTATTTTCGCAACAC
GCGACGATACGAATT
Sequence Comment 3R:19505571..19505870dmel-3R-chromosome-r4.1.1.fasta. 5' upstream sequence from genome annotation release 4.1.1. This is not raw data.

Library Name / Clone Name GSV1
Insertion Point 19505870 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Flanking Sequence
CCGAATAGCCGACTGCAGACTGAGCACCAGGTAAACGCGCGAGATGAGCGAGACCATAAA
CACCGCGGCTCAGTTCCCGAGCTTCGAGAAGCCGACCGTGCAGTTCAATGAAAAGGGCTG
GGGTCCCTGCGAGCTGCCCGATACGTTCAAGGATGTGCCGTACCAGCCGTTCAGCAAGAA
CGATCGTCTGGGCAAGATCTGCGACTGGACGAATACGTCGAACAACGACAAGAAGTACCA
GAGTGAGTTTATTCCCCACCCGAAACCGACCCACAAAATACTAATCGCCGAAAGTGAGGT
Sequence Comment 3R:19505870..19506169dmel-3R-chromosome-r4.1.1.fasta. 3' downstream sequence from genome annotation release 4.1.1. This is not raw data.

CLOSE