Strain Information | |
---|---|
DGRC Number | 200507 |
Genotype with FlyBase Link | y[1] w[67c23]; P{w[+mC]=GSV1}sle[GS3144] / TM3, Sb[1] Ser[1] |
Genotype | y1 w67c23; P{w+mC=GSV1}sleGS3144 / TM3, Sb1 Ser1 |
Break points/Insertion Site | 86A2 |
Map Viewer | |
Related Genes | CG12819(CT31949) |
Received Date | 12/20/02 |
Original Number | 3144 |
Comments | Received from Tokyo Metropolitan University. |
Original Comments | Vector: GSV1 Location (tagged genes): 5'UTR Function / Process (tagged genes): ligand binding or carrier |
General Information | GS_lines |
Genus | Drosophila |
Subgenus | Sophophora |
Species Group | melanogaster |
Species Subgroup | melanogaster |
Species | melanogaster |
Reference | Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T. The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster. Genetics (1999) 151(2) 725-37 [RRC reference] |
Last update | 2022-02-15 |
Research papers using this strain [Please submit your publication] |
Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T. The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster. Genetics (1999) 151(2) 725-37 [PubMed ID = 9927464] [RRC reference] Nelson B, Nishimura S, Kanuka H, Kuranaga E, Inoue M, Hori G, Nakahara H, Miura M. Isolation of gene sets affected specifically by polyglutamine expression: implication of the TOR signaling pathway in neurodegeneration. Cell Death Differ (2005) 12(8) 1115-23 [PubMed ID = 15861189] [RRC reference] |
Stock Request |
Library & Clone Information |
---|
Library Name / Clone Name | GSV1 |
Insertion Point | 6158885 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421) |
Flanking Sequence | GCTTAAATGATATCGGCTACTTTATCGGTGCCGAAACAGGCCAATGCTGCACAGCGTCTA AATCGGACGAACTATTAAGTGATTTTGCACTTAAAATAAGAAGATAGAAACCTAATTTCG AATAAAATTTAATTTAAGATAATTCATCAGTTGAAGGTGATATTAGGCTATCGACACATT GAATTTAGCCCCGAAACTATACTAGTTTGAATTCTAACGGCCGCCACACAAATGCTCAAC AGCCGGCTGCAGTGT |
Sequence Comment | 3R:6158586..6158885dmel-3R-chromosome-r4.1.1.fasta. 5' upstream sequence from genome annotation release 4.1.1. This is not raw data. |
Library Name / Clone Name | GSV1 |
Insertion Point | 6158885 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421) |
Flanking Sequence | GCTCGGCGTCTTGGCGTCTTCGTTTCTATTTCTTTGTTATAATTTGCATGCGGGTTCGAA ACTCTCTTGATTTCAATTAATTGTTGTGTGCGAAAAACAAAAGAGCCGGGCCAAATGGAT GATAATACGGAGAACACAGATGGAAAGCGCGGTGAGTGAATCTAAGCGTGCTGTGCTGAA AAAGCAACGGGACAAGTAAACCGGCGCTCCAAAGTCAGCCATTAACGGGGGGCTCCTATC TCAAGCAGGTCGCCTTTGCATTCGATCGAATAAAATTTATTCTTACACATTATTCATTTT |
Sequence Comment | 3R:6158885..6159184dmel-3R-chromosome-r4.1.1.fasta. 3' downstream sequence from genome annotation release 4.1.1. This is not raw data. |