Detailed Information [200767]
Strain Information
DGRC Number 200767
Genotype with FlyBase Link w[*]; P{w[+mC]=GSV2}CG8798[GS5186] / TM3, Sb[1] Ser[1]
Genotype w*; P{w+mC=GSV2}CG8798GS5186 / TM3, Sb1 Ser1
Break points/Insertion Site 76B11
Map Viewer
Related Genes CG8798(CT25352)
Received Date 1/22/03
Original Number 5186
Comments Cy, SM1 floating. 3Apr2013 T.O.
Received from Tokyo Metropolitan University.
Original Comments Vector: GSV2
Location (tagged genes): Upstream
Function / Process (tagged genes): ligand binding or carrier
General Information GS_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Reference Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [RRC reference]
Last update 2022-02-15
Research papers using this strain
[Please submit your publication]
Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [PubMed ID = 9927464] [RRC reference]

Library & Clone Information
Library Name / Clone Name GSV2
Insertion Point 19577423 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Flanking Sequence
AGATCGGGTCCCATAATAATATCCCCGTTGGAATCATCCCGCTTGCGGCTGTAGAAGCGC
TGCACCATCAAATTGGCTCCGTGGAGCCGCTGGAGGCGCAACGACCGATCCCGGCAGTAT
TGCATCAGGGAACTCTGAATGGGACGATTCCGGTTCCACACTGACGACGAGGCGATGCCA
CGCATCATGGGGCGCACTCGGATAGCGCGGGCTAACATATTGAAAGCAATATCCACTCGC
AATTTACTTAGAAAT
Sequence Comment 3L:19577124..19577423dmel-3L-chromosome-r4.1.1.fasta. 5' upstream sequence from genome annotation release 4.1.1. This is not raw data.

Library Name / Clone Name GSV2
Insertion Point 19577423 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Flanking Sequence
GAGTGATTATGTGACGGCTGGTGAAATGACAGCGGCTGACAGTGCTGCAAAACGATTTCT
TCTATTGTTGCACAGTGGTACCGGTGAAATTTTTTTTTTGTTCTACACCGCATGAACCCA
ATGACGTCGACAACGTTGTCCCTTATTTAGAGCATTTTTTTAATTTTGGAATTAATTTTT
TGAATTTTGTAAGTAAAAAGCATCCATTATAAAATAAATCTTAATTTTTTGTTTTATATG
TAAATTCGGTGATTTAAAATTTCCGAAGCTTTGTGTTTTAAGCCCACAGTACATTCAGTG
Sequence Comment 3L:19577423..19577722dmel-3L-chromosome-r4.1.1.fasta. 3' downstream sequence from genome annotation release 4.1.1. This is not raw data.

CLOSE