| Strain Information | |
|---|---|
| DGRC Number | 201233 |
| Genotype with FlyBase Link | y[1] w[67c23] P{w[+mC]=GSV2}GS7407 / Binsinscy |
| Genotype | y1 w67c23 P{w+mC=GSV2}GS7407 / Binsinscy |
| Break points/Insertion Site | 3A6 |
| Map Viewer | ![]() |
| Received Date | 1/22/03 |
| Original Number | 7407 |
| Comments | Received from Tokyo Metropolitan University. |
| Original Comments | Vector: GSV2 Location (tagged genes): Function / Process (tagged genes): |
| General Information | GS_lines |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Reference | Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T. The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster. Genetics (1999) 151(2) 725-37 [RRC reference] |
| Last update | 2022-02-15 |
| Research papers using this strain [Please submit your publication] |
Kirkland NJ, Yuen AC, Tozluoglu M, Hui N, Paluch EK, Mao Y. Tissue Mechanics Regulate Mitotic Nuclear Dynamics during Epithelial Development. Curr Biol (2020) 30(13) 2419-2432.e4 [PubMed ID = 32413305] [RRC reference] Kanda H, Shimamura R, Koizumi-Kitajima M, Okano H. Degradation of Extracellular Matrix by Matrix Metalloproteinase 2 Is Essential for the Establishment of the Blood-Brain Barrier in Drosophila. iScience (2019) 16 218-229 [PubMed ID = 31195239] [RRC reference] Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T. The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster. Genetics (1999) 151(2) 725-37 [PubMed ID = 9927464] [RRC reference] |
| Library & Clone Information |
|---|
| Library Name / Clone Name | GSV2 |
| Insertion Point | 2401749 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421) |
| Flanking Sequence | CGAGGATGTGAGAGCACTCAAAAAAAAAAAAAGACAAACGCTCCCCACAAGAGAGTCAGA GTCACACAGAAAACAAAGGGACAGCACACCGTGGAATGTGCGACCGCCTGGAACGATGGC GCGCAACCTAATGTCTAAGAACCGTTGCTGCGATTCCCATCGCTGCCTCTGCTCTGCCGG CGTCGCCCGAAGACGCACGAAGGCCGAAAGCGCGACGGAGCCGAAGCGATTTGCGTGCTC TTGTTATTGTTTAAC |
| Sequence Comment | X:2401450..2401749dmel-X-chromosome-r4.1.1.fasta. 5' upstream sequence from genome annotation release 4.1.1. This is not raw data. |
| Library Name / Clone Name | GSV2 |
| Insertion Point | 2401749 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421) |
| Flanking Sequence | CTCTCTCTCTCCCTTACCCTCTCCCTCTATCCCTCTCTCGCTCACATGCGTGGGTGTCCG CTTACGCAGAGTTAGCTGCGCCTGCTCTCTCTCCTCTCGCTCTGCCTGTCCATCCTTATT TGCGGAGCGTAGTCGCGATTTAGCCAGTCGGCTAAAGCAGCATTTAAGGCCGTAACGATA GAAAAAAAAAAGTAACTATCACTTTAGTTGGATAGTAAGCCCCCCCTCCCCCATTTTTTT TTACTCAACACCCGCCCAAGTGGCTCTCGCTCTCTGGGTCAACTGATAAACAAGTGAAAA |
| Sequence Comment | X:2401749..2402048dmel-X-chromosome-r4.1.1.fasta. 3' downstream sequence from genome annotation release 4.1.1. This is not raw data. |