Detailed Information [201233]
 

Strain Information
DGRC Number 201233
Genotype with FlyBase Link y[1] w[67c23] P{w[+mC]=GSV2}GS7407 / Binsinscy
Genotype y1 w67c23 P{w+mC=GSV2}GS7407 / Binsinscy
Break points/Insertion Site 3A6
Map Viewer
Received Date 1/22/03
Original Number 7407
Comments Received from Tokyo Metropolitan University.
Original Comments Vector: GSV2
Location (tagged genes):
Function / Process (tagged genes):
General Information GS_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Reference Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [RRC reference]
Last update 2022-02-15
Research papers using this strain
[Please submit your publication]		 Kirkland NJ, Yuen AC, Tozluoglu M, Hui N, Paluch EK, Mao Y.
Tissue Mechanics Regulate Mitotic Nuclear Dynamics during Epithelial Development.
Curr Biol (2020) 30(13) 2419-2432.e4 [PubMed ID = 32413305] [RRC reference]

Kanda H, Shimamura R, Koizumi-Kitajima M, Okano H.
Degradation of Extracellular Matrix by Matrix Metalloproteinase 2 Is Essential for the Establishment of the Blood-Brain Barrier in Drosophila.
iScience (2019) 16 218-229 [PubMed ID = 31195239] [RRC reference]

Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [PubMed ID = 9927464] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name GSV2
Insertion Point 2401749 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Flanking Sequence 
CGAGGATGTGAGAGCACTCAAAAAAAAAAAAAGACAAACGCTCCCCACAAGAGAGTCAGA
GTCACACAGAAAACAAAGGGACAGCACACCGTGGAATGTGCGACCGCCTGGAACGATGGC
GCGCAACCTAATGTCTAAGAACCGTTGCTGCGATTCCCATCGCTGCCTCTGCTCTGCCGG
CGTCGCCCGAAGACGCACGAAGGCCGAAAGCGCGACGGAGCCGAAGCGATTTGCGTGCTC
TTGTTATTGTTTAAC
Sequence Comment X:2401450..2401749dmel-X-chromosome-r4.1.1.fasta. 5' upstream sequence from genome annotation release 4.1.1. This is not raw data.

Library Name / Clone Name GSV2
Insertion Point 2401749 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Flanking Sequence 
CTCTCTCTCTCCCTTACCCTCTCCCTCTATCCCTCTCTCGCTCACATGCGTGGGTGTCCG
CTTACGCAGAGTTAGCTGCGCCTGCTCTCTCTCCTCTCGCTCTGCCTGTCCATCCTTATT
TGCGGAGCGTAGTCGCGATTTAGCCAGTCGGCTAAAGCAGCATTTAAGGCCGTAACGATA
GAAAAAAAAAAGTAACTATCACTTTAGTTGGATAGTAAGCCCCCCCTCCCCCATTTTTTT
TTACTCAACACCCGCCCAAGTGGCTCTCGCTCTCTGGGTCAACTGATAAACAAGTGAAAA
Sequence Comment X:2401749..2402048dmel-X-chromosome-r4.1.1.fasta. 3' downstream sequence from genome annotation release 4.1.1. This is not raw data.

CLOSE