Detailed Information [201956]
 

Strain Information
DGRC Number 201956
Genotype with FlyBase Link y[1] w[67c23]; P{w[+mC]=GSV6}spi[GS9657] / SM1
Genotype y1 w67c23; P{w+mC=GSV6}spiGS9657 / SM1
Break points/Insertion Site 37F1
Map Viewer
Related Genes spi(CT29014)
Received Date 4/18/03
Original Number 9657
Comments Received from Tokyo Metropolitan University.
Original Comments Vector: GSV6
Location (tagged genes): Intron
Function / Process (tagged genes): cell adhesion
General Information GS_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Reference Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [RRC reference]
Last update 2022-02-15
Research papers using this strain
[Please submit your publication]		 Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [PubMed ID = 9927464] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name GSV6
Insertion Point 19567736 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Flanking Sequence 
AACAGCAACAACAACAACGATCAACTATATTAGAGTGTGGACGGCAAAAAGTGTGCATAC
ATACATGACAACAAAAACACCCGCTAATAAAAAATACTGTTGTGGCTGCTTCTTCTTCTG
CTCTTGCGTCTTTTACAACTTCTTCGGCAAGCCAGTTGTTGTTGCTGTAATTTTCATGTT
GCCTTGCTCTCTTTCATTCTTGGGCGTCGCTGCGAGTTCGTTGGCTCTTCTCGTTTCTGT
ATGTGTGTGTGTTTA
Sequence Comment 2L:19567437..19567736dmel-2L-chromosome-r4.1.1.fasta. 5' upstream sequence from genome annotation release 4.1.1. This is not raw data.

Library Name / Clone Name GSV6
Insertion Point 19567736 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Flanking Sequence 
TAAAAAATGCCAATACAGGAACAACAACACAGCTCGCTCTCTTTTCTCTGCCTGCAGTTT
CGAAAAAAAATTTACCGGTTTTTATGTTTTCGCAAAAAAGCTCAAGAAACAAGTCCTACA
AGTTTTAAATCGAGAGAGGAGAGAGCAGAAAAGGCGTGAGAGCCCAAAGAATGCGCATTT
AGCAGAGACAACAACCTTTTGAGGTGTGTTGCGTATACGTGCATATTCGCACACACACAC
CACCAACGCTTCAGCTCTCGCTCTCTTTTTCTCGCTTCGCCATCTCACTCTTACTCCATG
Sequence Comment 2L:19567736..19568035dmel-2L-chromosome-r4.1.1.fasta. 3' downstream sequence from genome annotation release 4.1.1. This is not raw data.

CLOSE