Detailed Information [202330]
Strain Information
DGRC Number 202330
Genotype with FlyBase Link y[1] w[67c23]; P{w[+mC]=GSV6}GS10113 / TM3, Sb[1] Ser[1]
Genotype y1 w67c23; P{w+mC=GSV6}GS10113 / TM3, Sb1 Ser1
Break points/Insertion Site 83A8
Map Viewer
Related Genes Itp-r83A(CT1329)
Received Date 2/18/03
Original Number 10113
Comments Received from Tokyo Metropolitan University.
Original Comments Vector: GSV6
Location (tagged genes): Intron
Function / Process (tagged genes): inositol-1,4,5-triphosphate receptor
General Information GS_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Reference Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [RRC reference]
Last update 2022-02-15
Research papers using this strain
[Please submit your publication]		 Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [PubMed ID = 9927464] [RRC reference]

Library & Clone Information
Library Name / Clone Name GSV6
Insertion Point 1349130 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Flanking Sequence 
CACTGACAATTTTCGCTCAGAATGAGCTTTCCGTATCGGATTTCACTGGCATCACATCTC
GCATACGCACCGTGGCACCAGGCAGCAGGCAGCTAGAGCTGTATTGCCTACTTTTCGACG
CCCGCTCAACGCGACGCCTGGCTTTTCCGCTTTTCCTTCCTTGCTTTTCCGGGGCTGTGA
AGGACAACGTGGCGCTTTGCGCGTTGCTCGTCTACTAAAAAAATCGTCTGGGCTCCTCCG
AAAATTCCTTAACTT
Sequence Comment 3R:1348831..1349130dmel-3R-chromosome-r4.1.1.fasta. 5' upstream sequence from genome annotation release 4.1.1. This is not raw data.

Library Name / Clone Name GSV6
Insertion Point 1349130 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Flanking Sequence 
GCTGAGCCACGCCTGCGCTGTGACATGTAAACAACTTCTGCCCGGAGAGCGGCCCTCTCT
CTTTGCCTCTCAGCTGTTTGGCGTCGCCCGCGATTTCGGTCAGCTGACTGCCGCCGCACG
CAGCGCGGCCGCTGCGCTGCTGCCGCGATGCCAGCGCCGACATTGACGTCTGCGTCTGTT
TGCATGCCAACCACTTGTGGCTGTCTGCCGCGTTGTTTTCGCATTTCCCACGCATGTGAC
TGAGCCCAAAGCTTTTCCTATGGCTTGACCGCCGAACGCTGGTTTACGCACCGGTTAGTC
Sequence Comment 3R:1349130..1349429dmel-3R-chromosome-r4.1.1.fasta. 3' downstream sequence from genome annotation release 4.1.1. This is not raw data.

CLOSE