Detailed Information [205841]
Strain Information
DGRC Number 205841
Genotype with FlyBase Link y[1] w[67c23]; P{w[+mC]=GSV6}Gdi[GS14514] / SM1
Genotype y1 w67c23; P{w+mC=GSV6}GdiGS14514 / SM1
Break points/Insertion Site 030B09
Map Viewer
Received Date 12 December 2006
Original Number 14514
Chromosome 2L
Comments Received from Tokyo Metropolitan University.
Original Source Toshiro Aigaki. Tokyo Metropolitan University.
Original Comments Nucleotide map: 9503530
Vector: GSV6
General Information GS_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Reference Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [RRC reference]
Last update 2022-02-15
Research papers using this strain
[Please submit your publication]
Ma Z, Liu Z, Huang X.
Membrane phospholipid asymmetry counters the adverse effects of sterol overloading in the Golgi membrane of Drosophila.
Genetics (2012) 190(4) 1299-308 [PubMed ID = 22234859] [RRC reference]

Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [PubMed ID = 9927464] [RRC reference]

Library & Clone Information
Library Name / Clone Name GSV6
Insertion Point 9503530 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Chromosome Band 030B09
Flanking Sequence
TTTTGTTAATTTCTATTGATATGCCAAACATATTGTTGAACTTTCTTGTTTGCATTCCAA
CTAGCTGAGTAAAGGGTATCAGATAGTCGAGGAAATCGACTATAGCGTACGCTCTCGTTT
TTTTTTTATTTTATTATTTTTGTCTTTCGTTTTCGTATTTTTGGTGCTTGAGTGCGTCGG
ACGGGTTCGATAAACTTTGTGGCATTAATTAGGCAAACTCTTTATGTTTTCATAGCTCCG
ATATAATTTGTATCG
Sequence Comment 2L:9503231..9503530dmel-2L-chromosome-r4.1.1.fasta. 5' upstream sequence from genome annotation release 4.1.1. This is not raw data.

Library Name / Clone Name GSV6
Insertion Point 9503530 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Chromosome Band 030B09
Flanking Sequence
TGATAGATAAATTATTTACCATTTGAAAACAATATCTTATTTATTTATTTTAATTCATTT
CAGAAGATCATGGCCTCTGCAACTAAGGGGTCACCCTCAAAAAACGTAACCAGGTGCTAG
AATCAACTTTTCGTTAGCTTGGTAGATTGCAATTGGAAACAAAGTTCACTTTAACTGAGA
TAAAACGCAGAGAATCCACACATATCCGGCGTAGATCGTGGCCAGGCCGAAGAATTTAAT
CTGATGGTTGTGGCTCGCGAAGATGCCTTCAGCGAACACGGAAGACTTGCGGCGAAAGTT
Sequence Comment 2L:9503530..9503829dmel-2L-chromosome-r4.1.1.fasta. 3' downstream sequence from genome annotation release 4.1.1. This is not raw data.

CLOSE