| Strain Information | |
|---|---|
| DGRC Number | 205862 |
| Genotype with FlyBase Link | y[1] w[67c23]; P{w[+mC]=GSV6}GS14577 / TM3, Sb[1] Ser[1] |
| Genotype | y1 w67c23; P{w+mC=GSV6}GS14577 / TM3, Sb1 Ser1 |
| Break points/Insertion Site | 078D06 |
| Map Viewer | ![]() |
| Received Date | 12 December 2006 |
| Original Number | 14577 |
| Chromosome | 3L |
| Comments | Received from Tokyo Metropolitan University. |
| Original Source | Toshiro Aigaki. Tokyo Metropolitan University. |
| Original Comments | Nucleotide map: 21503493 Vector: GSV6 |
| General Information | GS_lines |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Reference | Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T. The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster. Genetics (1999) 151(2) 725-37 [RRC reference] |
| Last update | 2022-02-15 |
| Research papers using this strain [Please submit your publication] |
Li X, Zhuo R, Tiong S, Di Cara F, King-Jones K, Hughes SC, Campbell SD, Wevrick R. The Smc5/Smc6/MAGE complex confers resistance to caffeine and genotoxic stress in Drosophila melanogaster. PLoS One (2013) 8(3) e59866 [PubMed ID = 23555814] [RRC reference] Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T. The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster. Genetics (1999) 151(2) 725-37 [PubMed ID = 9927464] [RRC reference] |
| Library & Clone Information |
|---|
| Library Name / Clone Name | GSV6 |
| Insertion Point | 21503493 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421) |
| Chromosome Band | 078D06 |
| Flanking Sequence | GCTCGGATAAAAGCCTACGCCACGACATGGCGGGGGATCGTGCCTTAAGTTCCAAGCAAT TGGCGGGGCGCATACATTCCGTGTACTGCAAAGATTTCGTGTAGGTTTATTTCCATCAAA GGCGCAAATTGACAATTTCGCGGCTCATTTGATTATTTCCAACAACAGATCCTACAGCGA GATCACATTCCATCCGAAGCACTACCTGAACGTTCTGACCGGTCCCAATGGCAGTGGCAA GTCCACCATCGTGTC |
| Sequence Comment | 3L:21503194..21503493dmel-3L-chromosome-r4.1.1.fasta. 5' upstream sequence from genome annotation release 4.1.1. This is not raw data. |
| Library Name / Clone Name | GSV6 |
| Insertion Point | 21503493 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421) |
| Chromosome Band | 078D06 |
| Flanking Sequence | GCTCCGCCAGCGTTGCCGACTACATACAGAGCAACAAAACCTCGGCCACCATAATTGTCC GGGTGTATGGACGCACGCCCAACACCACGGAAACCTTTCGGCGCATAATAAACTCTAATG GCTTGTCTACCTTCTCTGTGAACGACAAAGACACCTCCAAGAAGAACTTTTTGGCTGCTG TATCCTCCTTTAACATACAAGTCAGCAATTTGTGTCAGTTCCTCCCGCAGGATCGGGTTC AGGTATGTCGTTATGTTGGCAATTCATAAATTACACACCTATTTATTGTAAACATACTGT |
| Sequence Comment | 3L:21503493..21503792dmel-3L-chromosome-r4.1.1.fasta. 3' downstream sequence from genome annotation release 4.1.1. This is not raw data. |