Detailed Information [205862]
Strain Information
DGRC Number 205862
Genotype with FlyBase Link y[1] w[67c23]; P{w[+mC]=GSV6}GS14577 / TM3, Sb[1] Ser[1]
Genotype y1 w67c23; P{w+mC=GSV6}GS14577 / TM3, Sb1 Ser1
Break points/Insertion Site 078D06
Map Viewer
Received Date 12 December 2006
Original Number 14577
Chromosome 3L
Comments Received from Tokyo Metropolitan University.
Original Source Toshiro Aigaki. Tokyo Metropolitan University.
Original Comments Nucleotide map: 21503493
Vector: GSV6
General Information GS_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Reference Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [RRC reference]
Last update 2022-02-15
Research papers using this strain
[Please submit your publication]
Li X, Zhuo R, Tiong S, Di Cara F, King-Jones K, Hughes SC, Campbell SD, Wevrick R.
The Smc5/Smc6/MAGE complex confers resistance to caffeine and genotoxic stress in Drosophila melanogaster.
PLoS One (2013) 8(3) e59866 [PubMed ID = 23555814] [RRC reference]

Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [PubMed ID = 9927464] [RRC reference]

Library & Clone Information
Library Name / Clone Name GSV6
Insertion Point 21503493 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Chromosome Band 078D06
Flanking Sequence
GCTCGGATAAAAGCCTACGCCACGACATGGCGGGGGATCGTGCCTTAAGTTCCAAGCAAT
TGGCGGGGCGCATACATTCCGTGTACTGCAAAGATTTCGTGTAGGTTTATTTCCATCAAA
GGCGCAAATTGACAATTTCGCGGCTCATTTGATTATTTCCAACAACAGATCCTACAGCGA
GATCACATTCCATCCGAAGCACTACCTGAACGTTCTGACCGGTCCCAATGGCAGTGGCAA
GTCCACCATCGTGTC
Sequence Comment 3L:21503194..21503493dmel-3L-chromosome-r4.1.1.fasta. 5' upstream sequence from genome annotation release 4.1.1. This is not raw data.

Library Name / Clone Name GSV6
Insertion Point 21503493 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Chromosome Band 078D06
Flanking Sequence
GCTCCGCCAGCGTTGCCGACTACATACAGAGCAACAAAACCTCGGCCACCATAATTGTCC
GGGTGTATGGACGCACGCCCAACACCACGGAAACCTTTCGGCGCATAATAAACTCTAATG
GCTTGTCTACCTTCTCTGTGAACGACAAAGACACCTCCAAGAAGAACTTTTTGGCTGCTG
TATCCTCCTTTAACATACAAGTCAGCAATTTGTGTCAGTTCCTCCCGCAGGATCGGGTTC
AGGTATGTCGTTATGTTGGCAATTCATAAATTACACACCTATTTATTGTAAACATACTGT
Sequence Comment 3L:21503493..21503792dmel-3L-chromosome-r4.1.1.fasta. 3' downstream sequence from genome annotation release 4.1.1. This is not raw data.

CLOSE