Detailed Information [206187]
 

Strain Information
DGRC Number 206187
Genotype with FlyBase Link y[1] w[67c23]; P{w[+mC]=GSV6}GS15374 / TM3, Sb[1] Ser[1]
Genotype y1 w67c23; P{w+mC=GSV6}GS15374 / TM3, Sb1 Ser1
Break points/Insertion Site 062A03
Map Viewer
Received Date 1 Februay 2007
Original Number 15374
Chromosome 3L
Comments Received from Tokyo Metropolitan University.
Original Source Toshiro Aigaki. Tokyo Metropolitan University.
Original Comments Nucleotide map: 1529637
Vector: GSV6
General Information GS_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Reference Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [RRC reference]
Last update 2022-02-15
Research papers using this strain
[Please submit your publication]
Banerjee SJ, Schonbrun A, Eizadshenass S, Benji S, Cantor YT, Eliach L, Lubin M, Narrowe Z, Purow J, Shulman B, Wiener L, Steinhauer J.
iPLA2-VIA is required for healthy aging of neurons, muscle, and the female germline in Drosophila melanogaster.
PLoS One (2021) 16(9) e0256738 [PubMed ID = 34506510] [RRC reference]

Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [PubMed ID = 9927464] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name GSV6
Insertion Point 1529637 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Chromosome Band 062A03
Flanking Sequence
GAATTCGAGATTTCATGCTGTGAATGAACATGTTACGTTTTTGCCGCAAATGGTAGGTTT
AGGATTCATAGCCAGTGTTATTTTTGAATTATTATTAAATTAAATTTAAATTTGACACTT
TATTGTCATTCTACAAATTTAAAAATTGAATTTTTAAACTATTTCGATAACTGTTTAAAG
TTCATTCATTCCACGACCCAAAACAGTGAAAGTATTCGATAAGATATCGGTCTCCCCATG
CGTCATCGATGGTAT
Sequence Comment 3L:1529338..1529637dmel-3L-chromosome-r4.1.1.fasta. 5' upstream sequence from genome annotation release 4.1.1. This is not raw data.

Library Name / Clone Name GSV6
Insertion Point 1529637 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Chromosome Band 062A03
Flanking Sequence
CTAGGGTTATTCGAAGTTGTGTTTGTGTCCGACGAACAACAAACGAATTGTTAACAGACC
GAGTGGGGTGACTTGTGGTCCGCGTTTCGTGTGTGTGTCATTCCAGACGAAAACGAAGAT
TTGCTTCGACAAGCAGAGAAAAGAAGGGACCAGCTCCAATCGATAATCGAAAGAACCGTT
CCGAGTTGGAAGAAAGTGGAAAGTAAGTGGAGAGTGGAAACTATTTTGGTTCGGTGCGTT
TTTTCAATGCGGGTCACTGGGAAATGCAGACACATTCACGGTGCCGAGCGGATGACGTGA
Sequence Comment 3L:1529637..1529936dmel-3L-chromosome-r4.1.1.fasta. 3' downstream sequence from genome annotation release 4.1.1. This is not raw data.

CLOSE