Detailed Information [206424]
Strain Information
DGRC Number 206424
Genotype with FlyBase Link y[1] w[67c23]; P{w[+mC]=GSV6}GS15934 / TM3, Sb[1] Ser[1]
Genotype y1 w67c23; P{w+mC=GSV6}GS15934 / TM3, Sb1 Ser1
Break points/Insertion Site 086B04
Map Viewer
Received Date 1 Februay 2007
Original Number 15934
Chromosome 3R
Comments Received from Tokyo Metropolitan University.
Original Source Toshiro Aigaki. Tokyo Metropolitan University.
Original Comments Nucleotide map: 6233005
Vector: GSV6
General Information GS_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Reference Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [RRC reference]
Last update 2022-02-15
Research papers using this strain
[Please submit your publication]
Ge W, Deng Q, Guo T, Hong X, Kugler JM, Yang X, Cohen SM.
Regulation of pattern formation and gene amplification during Drosophila oogenesis by the miR-318 microRNA.
Genetics (2015) 200(1) 255-65 [PubMed ID = 25786856] [RRC reference]

Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [PubMed ID = 9927464] [RRC reference]

Library & Clone Information
Library Name / Clone Name GSV6
Insertion Point 6233005 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Chromosome Band 086B04
Flanking Sequence
GCGACTCCACGTAGTTCTGGTAGTCAGTCTCCATATCCAAATCGTTAAAAATCAGACTTA
ATTTATTCCTCCTACTGTCTCGTCTCCTGAATATCGTCCGTGTTCCTCCGGCTCCGGCCG
AAATGCGGCTGTGTCCTGAGTCCTAGCGCCTCTGATCGACTGGCGTGTAGCGCCAGTGGT
GCTCATCGGACTCTGGACCTTTTCAACCACCGCTTGAGGGTCCAAATATTACAGCATCAT
CGCCTTTTCGTTATA
Sequence Comment 3R:6232706..6233005dmel-3R-chromosome-r4.1.1.fasta. 5' upstream sequence from genome annotation release 4.1.1. This is not raw data.

Library Name / Clone Name GSV6
Insertion Point 6233005 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Chromosome Band 086B04
Flanking Sequence
ACAAAAATCTATGTTGGTTCGATACTATCAACAACAATGCCAGTAGCATTAGTTATCGAT
AAGAACAAAATCAAGAATCGTAATTGAACTATCGATAGATAGAGCTTCAAGGGCGGTTTG
TTCAAATGCTAGTTTCTGTAGCTATGAATTAAATTTAACTTTTGTTTGTATGTAAGTGAA
TAAACACATTCCATTGGTACGGTACATAACGAATTTAGGGAATTCTTGTATAATGTTCTA
TATTTTAATTTGTAACTACATTGGTTTAGTTTCGATGACAAATCAGCATATTGAGGTGGA
Sequence Comment 3R:6233005..6233304dmel-3R-chromosome-r4.1.1.fasta. 3' downstream sequence from genome annotation release 4.1.1. This is not raw data.

CLOSE