Detailed Information [206863]
Strain Information
DGRC Number 206863
Genotype with FlyBase Link y[1] w[67c23]; P{w[+mC]=GSV6}GS16990 / SM1
Genotype y1 w67c23; P{w+mC=GSV6}GS16990 / SM1
Break points/Insertion Site 034D03
Map Viewer
Received Date 1 Februay 2007
Original Number 16990
Chromosome 2L
Comments Received from Tokyo Metropolitan University.
Original Source Toshiro Aigaki. Tokyo Metropolitan University.
Original Comments Nucleotide map: 13793624
Vector: GSV6
General Information GS_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Reference Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [RRC reference]
Last update 2022-02-15
Research papers using this strain
[Please submit your publication]
Wang Y, Zhang H, Shi M, Liou YC, Lu L, Yu F.
Sec71 functions as a GEF for the small GTPase Arf1 to govern dendrite pruning of Drosophila sensory neurons.
Development (2017) 144(10) 1851-1862 [PubMed ID = 28420712] [RRC reference]

Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [PubMed ID = 9927464] [RRC reference]

Library & Clone Information
Library Name / Clone Name GSV6
Insertion Point 13793624 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Chromosome Band 034D03
Flanking Sequence
ATATTCATTAAAGATTTGTAAGTACTATTTACTACACATATTTACACAAATAATTTATTT
TAAATATAACTTTATTGTTTACTTTTTTCTTTTGTTATCACAAATCGCCGTTACAAATTC
AAATAACAATAACACCAGCAAATTAGCAAAAATACCAAAACCGAGAGAATACCAAAAACT
TCCCAACACTGCCGACAGCTCAGTAATTTTCGCTTACACGGTCACACTTCTGATGACGTT
TTTTCGTATTTTGAA
Sequence Comment 2L:13793325..13793624dmel-2L-chromosome-r4.1.1.fasta. 5' upstream sequence from genome annotation release 4.1.1. This is not raw data.

Library Name / Clone Name GSV6
Insertion Point 13793624 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Chromosome Band 034D03
Flanking Sequence
CATCCACGACACGCTAAAAACTCACCGAGTGCCGCCACACGACAATCCAACCGAGAGGAG
CACTCCGCACAGCTGGCGGAGCACCCAGAAGGCAGCAGGCGAAAGTTGCGTGGCTGTTGT
TTCCGGAAGCGGTGGGCAGAGGGAAATCCGAAGCAGTGGTAGTAGGGAAAGAGGCATCGA
AACCCACCCAGCGAAGGCGACCTTGGGAGTGGCAGCGGCCCAATATGCACAACAACTCCA
CAAAAACCAAGGAAATGTTCATCGTGCGTGCTCTAGAAAAGATCCTTGCCGATAAGGACA
Sequence Comment 2L:13793624..13793923dmel-2L-chromosome-r4.1.1.fasta. 3' downstream sequence from genome annotation release 4.1.1. This is not raw data.

CLOSE