Detailed Information [207339]
Strain Information
DGRC Number 207339
Genotype with FlyBase Link y[1] w[67c23]; P{w[+mC]=GSV2}GS51457 / TM3, Sb[1] Ser[1]
Genotype y1 w67c23; P{w+mC=GSV2}GS51457 / TM3, Sb1 Ser1
Break points/Insertion Site 088D01
Map Viewer
Received Date 2007
Original Number 51457
Chromosome 3R
Comments Received from Tokyo Metropolitan University.
Original Source Toshiro Aigaki. Tokyo Metropolitan University.
Original Comments Nucleotide map: 10549656
Vector: GSV2
General Information GS_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Reference Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [RRC reference]
Last update 2022-02-15
Research papers using this strain
[Please submit your publication]
Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [PubMed ID = 9927464] [RRC reference]

Library & Clone Information
Library Name / Clone Name GSV2
Insertion Point 10549656 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Chromosome Band 088D01
Flanking Sequence
TTTTCACCCGACGCGCGCCTTTTCTTTCTTTTCGCTATTGCTATCTACGTTTGCTTCTTT
TTTCGGGGGGTTTCTCTTTGCGCTGTTTACATTAGCAAAGACATTTCAATTCCGTTTCTT
TTGCTCCGGCGATAATGGAGACCGACCCGCACACACACACACACAACACGGCCACACGGT
GACGGGCGTAGAGGCACACACCGAGCCAACTCGAATACACACGCGCGCAGGGGAGAGAGA
GCGGGAGAGCGCGGG
Sequence Comment 3R:10549357..10549656dmel-3R-chromosome-r4.1.1.fasta. 5' upstream sequence from genome annotation release 4.1.1. This is not raw data.

Library Name / Clone Name GSV2
Insertion Point 10549656 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Chromosome Band 088D01
Flanking Sequence
TTCCAGCTCAAACACACGCACACATATGGGGGACGAACACAAGCGCACACGATCACTGCT
CACAGTTGGTGCTGCTTCTTTTCATTTCTTGTTGTTGCAAGCGTTTGAACTCCTTTACTT
ATTTTCTTATTTTCGCCTAATTGAAACTAATTAACGACGATAATCCAACCATCCACTTGG
TGTTCACAAAAAAATATGTACTTCAGTTTAGTGAGTTCGCGCCGTCGCCGATCTCTTCGG
TTCCGGAATTCCTTGGGGGAGCAGCAAAAAACACGAGTAGCGCGCTTGATGACCGTCCGA
Sequence Comment 3R:10549656..10549955dmel-3R-chromosome-r4.1.1.fasta. 3' downstream sequence from genome annotation release 4.1.1. This is not raw data.

CLOSE