Detailed Information [103491]

Strain Information
DGRC Number 103491
Genotype with FlyBase Link w[*] P{w[+mW.hs]=GawB}NP0004 / FM7c
Genotype w* P{w+mW.hs=GawB}NP0004 / FM7c
Break points/Insertion Site 17E1
Map Viewer
Related Genes CG7058 CG7095
Original Number 4
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP0004
NP line. Received from the National Institute of Genetics.
Balancer FM7c
Cluster id 435
General Information NP_lines
Embryonic Expression sg, pns, a small # of cells, sg
Larval GFP cns + pns, gut, tr
Larval X-gal sg, gut
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np51755_0227
Strand Plus
Insertion Point 18545083
Chromosome Band X
Flanking Sequence
atcttttngtgcactgacnttaattttatacttcggtaagcttcggctatcgacgggacc
accttatnttatttcatcatgCGGTGGACGTAAATATTTAATTGCCCACTGGGTGTATGA
GTGTATGTATGTATGTGTGTATACACACGGTTGTATAAAAATACGGAAATGTGTGTACTT
GGTGATTTTTGTTTATTGTATGTTATTGCAAACGAATTTCGAATAGCCAAAGGTGTGAGA
GAGTTCAACGAAAGCAACAAAAAGAGCAGCAGCAGCGGCGAAGTCCTGAACTCCCCAAGT
GAAATAACTGTTTTTGCGCAAAGTATTCTGGCGTTATTGTTGTTGTTGTTGTTGTTACTG
CTGCTGCTGCTGCTGCTATCTGGTTGTTGATATTGTTGTTGCACACACACACACACTAAC
AGGCACCCTAGCAAAATCATCATCAATTACNCCCCCTCCATANAAAAACCGGAGAGTGTA
TGCGTGTGTGTGCGCCTATCAAAGCTCTCTCTTCGCCGACACTCACTTACACACACGCAT
GCAATAGCACCCGCACCCGACACACACACACACACACACACACACACNCGGGCNCACATA
NAAATATACNCCCNCTATANNCACACTTTCTTTGANACTGCCCCGNNNTAGTTATTAGCT
TGTNCCCCCCCTTNNACAGNGGNNNTCNTNCCCAANAAAGTNTAAAAAATGTTTTTTNTT
TNNNANAAAAAANATAANAAANACCNNNNNAAAANANCNCATTTTGTNGGNNNCATTTTT
ANGGNGGGNNNNNNNNCCNNttnnntttttttnacnnannanannnnttaananntcccn
ngnnnnaaancnccnnnatnnnnnttntttnnttnnncccnnnnnnntttnnnnctnntn
tttntncnnncnnncnctnncnnctttnn

Image Files
Disc

d1 (->Large)


CLOSE