Detailed Information [103492]

Strain Information
DGRC Number 103492
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP0007 / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}NP0007 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 73E4
Map Viewer
Related Genes CG14059 G2{}1019
Original Number 7
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP0007
NP line. Received from the National Institute of Genetics.
Balancer TM6UW23-1
Cluster id 1948
General Information NP_lines
Lethality semi lethal
Embryonic Expression a small # of cells, sg
Larval GFP sg
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np18015_0807
Strand Minus
Insertion Point 16981172
Chromosome Band 3L
Flanking Sequence
attgttagcgtgcactgactttnagtgtatacttcggtaagcttcggctatcgacgggac
caccttatgttatttcatcatgCTCCATACCCGAAACCGAAACCGAAGAATTACAAATCC
CGAAATCTGCTCTCTCTCTCTCTCTCTCTCTCACCCCCATCGCCCATTCCCATTGAAAAG
TGAAGAGCGGCTGTCTGAGCGGCAAACTGAGCCgatcgaagaatacataagagagaaccg
tcgccaaagaacccattattgnnggggtccgttttcaggangggcaagccatccgacatg
tcatnctcttcagaccaatcaaatccatgaagagcatccctgggcataaaatccaacgga
attgnggagttatcatgatgagctgccgagtcaatcgatacagncaactgtctttgacct
ttgttactactctcttccgatgatgatgtcgcacttattctatgctgtctcaatgtnaga
ggcatatcagtctccactgagcatnnnnnnnnnggggggnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Library Name / Clone Name np / np58333_0309
Strand Plus
Insertion Point 16981165
Chromosome Band 3L
Flanking Sequence
ngaggggccngccnnngnnccngttttttggnnnnggncacttgnngnncaanaaaccnc
cagttttacgttantggangtctcttgccgacgggcaccaccttatgttatttcatcatg
GTATGGAGTATGGGGTATGGGTTATGGGGTTCGGTCTCGGCTTTTTGGGGATCCTCTAGC
TAGAGCTTTGCGTACTCGCAAATTATTAAAAATAAAACTTTAAAAATAATTTCGTCTAAT
TAATATTATGAGTTAATTCAAACCCCACGGACATGCTAAGNGTTAATNAACATATATAAT
GGTGCCNNCTNTTNATCCTNTANCTANAGCTNTGNNNNNNNNNNNNNTNNNNNNNNNNNN
NNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNACCANNNNANNNNANNNNANNANNN
NNNNNNNNNNGNNNNANGNNNNATNGNNNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nncn

Image Files
Disc

d1 (->Large)


CLOSE