Detailed Information [103493]

Strain Information
DGRC Number 103493
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}l(2)k09913[NP0009] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}l(2)k09913NP0009 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 59C3
Map Viewer
Related Genes Dox-A3 l(2)k09913
Original Number 9
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP0009
NP line. Received from the National Institute of Genetics.
Balancer CyUW14
Cluster id 922
General Information NP_lines
Embryonic Expression sg, cns + pns subset
Larval GFP gut
Larval X-gal gut, fb, mt
Adult GFP abdomen
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np51765_0227
Strand Minus
Insertion Point 18111079
Chromosome Band 2R
Flanking Sequence
gngggcncgnnnngttntgtttttttggnnnngatnactgnnggtcataaaccctanttt
ttngacttncggtaagacttcggctatcgacgggnaccaccttatgttatttcatcatgG
ACTGAACTTTGTACCCAGTGCAGACGAGTCTCAATTTGTATTGTCAAATGGCCAGAATGC
TAAATTgatcgaagantacataagagagaaccgtcgccaaagaacccattattgttgggg
tccgttttcaggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaatcca
tgaagagcatccctgggcataaaatccaacggaattgtggagttatcatgatgagctgcc
gagtcaatcgatacagtcaactgnctttgacctttgttactactctcttccgatgatgat
gtcgcacttattctatgctgtctcaatgttagaggcatatcagtctccactgaagccatc
nnaatnntgnannannntccacngaagncgatgnnntnnnnttnnnnnnntnctgnnnna
angnnnnaggnntnnnagnntnnantgnnnnnatnnannttgnnnncnnnnnannnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntnnnnnnntnnnnn
nnnnnnnnnngnnnnnnnnnnnnnnnnnnnnnnnntntnnttnnnnnnnnnnnnnnnnnn
nnnnnntnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntnnnnnnnnnnnn
tntnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntnttnttntnnnnnnntnntntn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnaatnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnntnnnnnnnnntnnn

Image Files
Disc

d1 (->Large)


CLOSE