Detailed Information [103497]

Strain Information
DGRC Number 103497
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP0022 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype w*; P{w+mW.hs=GawB}NP0022 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 21C7
Map Viewer
Related Genes ush EP2237
Original Number 22
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP0022
NP line. Received from the National Institute of Genetics.
Original Comments comment1:A, comment2:21C4
Balancer CyUW14
Cluster id 982
General Information NP_lines
Embryonic Expression AS subset, PNS subset? dorsal aorta
Larval GFP dorsal epi, cns, tr associated cells
Larval X-gal
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np08035_0711
Strand Minus
Insertion Point 492540
Chromosome Band 2L
Flanking Sequence
tttaacgtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggaccac
cttatgttatttcatcatgCTTAAAGACGTCCGTTCGAAGCAAGCGCTCGCTCACGAATG
AAACGCAAAGCGAATCCGAAACCGACACGAAAGCTCTCCAGTTGGCCAAAGAGAGAGAGA
GAAGGAGAGAGAGAGGGAGAGAGATAGGGAGAGAGAGAGAGAGGGGAGGAGAGCGCNCNA
TCTTATTAGAGCGCGCGCATTTCTTTCCATTTTGTTTTGNACTCGGTTTTTCATCGCTCC
GNATGCTTTCGCGTNTGCTTCGCAGTCTGATAAGAATCAAAACAAAAACGCCGAAACATT
TACGCACGTTTTCACACTTTTCTCACCATCCTTCCTTCTCTTTCCATTNAACGCATTTGC
ATCGGTATTTACCAAATTCTTGNNGGAAATTCTTGCTCATTGAAGTTCTCTTCTNCTATA
TTCTGCCATCTACTAATTGGTGCTACCCACAAGCTGAAAACTACTCGTTCACTTTGGGTT
TAAGCACTAGATTTTTTTATTTTCTTCCCACTTTCTTTTTTTGNACACTTTTTTGACTAC
AGCAGCTGGCAATAGGCTTTAGTGTTAAAAACCCACCACGCATTTNTGAGAAAAATGAAA
AGATTCCNTTTGGGCCACTNGNTGGCGCTTTCACACCGNTTGNAAGGNATTCTTTTAGGN
TTNTCCNATAAGATGGCCCCCANAAGGCGCCNTTNAAAACCTGNNAAANGGGGTTNTTNT
TTTACCAANATNNCNNTTGTttttggcnaaaatnatnnangnnattnccannttnncccc
nanatttttttttctgtgggaanaaaccnnggnnnnntttttttttngctgcccttnccn
nttttttttgnaaaattnnttnnttnggnnnccccnngggngcccccctttttgnntt

Image Files
Disc

d1 (->Large)

d2 (->Large)


CLOSE