Detailed Information [103498]

Strain Information
DGRC Number 103498
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP0029 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype w*; P{w+mW.hs=GawB}NP0029 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 40E4
Map Viewer
Related Genes CG6448 S-element{}532
Original Number 29
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP0029
NP line. Received from the National Institute of Genetics.
Balancer CyUW14
Cluster id 1308
General Information NP_lines
Embryonic Expression sg, a small # of cells
Larval GFP sg
Larval X-gal
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np52255_0227
Strand Plus
Insertion Point 21967374
Chromosome Band 2L
Flanking Sequence
gttacgtgcctgaatttaagtgtatacttcggtaagcttcggctatcgacgggaccacct
tatgttatttcatcatgGTCTAAGACACGTTTACAGCTTTGCTCCGCTCAATTCAGTCTC
TATCTGAGCGTTGTCTTTGCGAGTTAGCCATTTGCAATCGTGCGGTCTTTTCAATGTGTC
TGTAGCCGCCCCAATTACATATGTATTTCGTCTGTGGATATATGTACGATGTACATATGT
ATATAGGATGTACACATTTGTACATATAAATATATGAACAATGCCTATTTCTCCAGCTTT
CGTTTACAGTAGTTTTGAGAAAGAAGTGTATCTGAGTGTTTACGTGAATATTGAGGGCAC
AAAACAAAATAGCAGAGCAAAGAAAAAATAGCTCGTTGTAAATTAGACATGGAGAACATA
CAATGCCTTTCAAAAAATTATAAAAGTGACCAGAAGACCGCGGAGATTTCGTTGTCGCGC
TTGTCATATTGCCCAACCGGTCAGGACTCTTTCTACTGAACATTCTATTGTTATTTTATA
TAAGTATCTATGTACAGATGTATGTATGTTGAAGCCGAATAAAAAATTAAGCATGGATTT
GTATATAAATAAAAATGTTTACTGCATTCCCGACATATCAACAACACAATACATGTAAAT
GTATGTGTATGTACATGCATATgatcgaagaatacataagagagaaccgtcgccaaagaa
cccattattgttggggtccgttttcaggaagggcaagccatccgacatgtcatcctnttc
agaccaatcaaatncatgaagagcatncctgggcataaaatccaacggaattgnggagnt
atcatgatgagctgncgagtcaatcgatccagtcaactgnctttgaccttggtactactc
tnttccgaggaggatgccnacttattta

Image Files
Disc

d1 (->Large)

d2 (->Large)


CLOSE