Detailed Information [103499]
 

Strain Information
DGRC Number 103499
Genotype with FlyBase Link w[*] P{w[+mW.hs]=GawB}l(1)G0148[NP0032] / FM7c
Genotype w* P{w+mW.hs=GawB}l(1)G0148NP0032 / FM7c
Break points/Insertion Site 6C3
Map Viewer
Related Genes CG3224 CG3226 CG32742
Original Number 32
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP0032
NP line. Received from the National Institute of Genetics.
Balancer FM7c
Cluster id 182
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression cns + pns (ch subset)
Larval GFP ubiquitous
Larval X-gal sg
Adult GFP abdomen
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np51855_0227
Strand Minus
Insertion Point 6395048
Chromosome Band X
Flanking Sequence
gnnnngnnnnngnnnnggtttttttnnnnnggantnccttgggtgncaaanaccccttga
nttgtttgacttncggtcaagncttcggctatcgacgggnaccaccttatgttatttcat
catgGTTCAGTTCCAGCCGGTTCGATGCCATCGATGGTTTTTTCGAGACTATGgatcgaa
gaatacataagagagaaccgtcgccaaagaacccattattgttggggtccgttttcagga
agggcaagccatccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatccc
tgggcataaaatccaacggaattgtggagttatcatgatgagctgccgagtcaatcgata
cagtcaactgtctttgacctttgttactactctcttccgatgatgatgtcgcacttattc
tatgctgtctcaatgttagaggcatatcagtctccactgaagccaatcttatctgtnctn
ctntntnncnangatgangnnnnnctnatnctatgctgnnncntggtngaggcntnnnan
ncntgactgggccactnatnntnngnngnnnnannnnnnnnngnnnnnnnnnnnnnannn
nnnncnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnn

CLOSE