Detailed Information [103510]

Strain Information
DGRC Number 103510
Genotype with FlyBase Link w[*] P{w[+mW.hs]=GawB}CG1632[NP0055] / FM7c
Genotype w* P{w+mW.hs=GawB}CG1632NP0055 / FM7c
Break points/Insertion Site 7E1
Map Viewer
Related Genes CG10965 CG15343 CG1632
Original Number 55
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP0055
NP line. Received from the National Institute of Genetics.
Balancer FM7c
Cluster id 218
General Information NP_lines
Embryonic Expression cns + pns subset
Larval GFP sg
Larval X-gal sg, tr
Adult GFP internal
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np51945_0227
Strand Plus
Insertion Point 8010358
Chromosome Band X
Flanking Sequence
attttngtgcactgaactaagtttatacttcggtaagcttcggctatcgacgggaccacc
ttatgttatttcatcatgGTTGGCACTCTGTTTTATGTGTTTTTTTTTTNGTNATNGNGG
GGNCCCTNGNTTTTTNTNGCTATCTCCNTTTTTCNTTTAATNTGCCTGCAGCTGCNCTAA
NAGTNGTNGTTTNTGNTNTCCNAGGAAAACCTTCNNAGGNAACGGGGGTNGCTNATGNGN
GTNCNCTCGGNCNNACATNGAANGGCAATNGGNGAGAGTAAAAAAGANAANCAAAANTTN
CTCATTCAACTTTGTTNTNGNTTCNACNGNTNGTTTTTGTNGCTNTACCCCAAGCNCNTT
GNTGNATGTCGNGNGCGTGNNACGTCNCNATCGAAAANTNCATAANAAANANCCGTCCCC
AAANAACCCATTNTTGTNGGGGNCCGTTTTNAGNAAGGGNAANCCATCCNACNTGTNATC
CTTTTAAAACCAATNAAATCCATGAANAGCNTCCCNGGGCANAAAATCCAACGGAATTGG
GGNGTNATNATNATNAGCTGCCGAGTAAATCGATNCAGNNAACNGTNTTTGACCTTTGTT
ACTNCTNTNTTCCGAGGATGANGGCGCNCTTATTCTATGCTGTNTAAATGTNANNGGCAT
ATNAGNCTCCCTAGNTANNNNNNNNNNGGNNNNNNNNNNNNNNNNNNAANNNNNNNNGGN
NNNNNNNNNNTCCNNNGAANCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Image Files
Disc

d1 (->Large)


CLOSE