Detailed Information [103514]

Strain Information
DGRC Number 103514
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}fray[NP0071] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype w*; P{w+mW.hs=GawB}frayNP0071 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 91B5
Map Viewer
Related Genes CG14306 CG7691 fray CG7694
Original Number 71
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP0071
y[*] seems to be lost. 20Nov2008 M.T.
NP line. Received from the National Institute of Genetics.
Balancer TM6UW23-1
Cluster id 1540
General Information NP_lines
Lethality lethal
Embryonic Expression one specific muscle
Larval GFP weak
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np05075_0711
Flanking Sequence
attttacgtgcactgaatttanttgtatacttcggtaagcttcggctatcgacgggacca
ccttatgttatttcatcatgCCCACGACTGTATTCATAAGTGCgatcgaagaatacataa
gagagaaccgtcgccaaagaacccattattgttggggtccgttttcaggaagggcaagcc
atccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatccctgggcataaa
atccaacggaattgtggagttatcatgatgagctgccgagtcaatcgatacagtcaactg
tctttgacctttgttactactctcttccgatgatgatgtcgcacttattctatgctgtct
caatgttagaggcatatcagtctccactgaagccatctttnttntnggggnngnnnnnnt
tnnnnnncnnnnnnnnngnncaannnnnnccngnnaacaanggntnnnannnnnctnnna
naaaacccntttncaaantnntggnnngggnnttnnnnnnggaaaaannannnnnaaaaa
nnntnnnncannnnnnnntnnccntggnnnnnnntnnnnnnnnannnnccnnnnnnnnnn
nnnnacnnnnnnnnnnnggnngannnnnnnnnntncnannngnnnnnnnnanannnnnnn
nncnnnnnnnnnnntnnnnnnnnnnnnnnnttnnannnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnn

Library Name / Clone Name np / np54833_0309
Strand Plus
Insertion Point 14411464
Chromosome Band 3R
Flanking Sequence
acttcttntgcgcactnactgcaagttntacgttaagtggatgtctcttgccgacgggna
ccaccttatgttatttcatcatgGNCGNGGGCNAGANANGTTAAACANTANCGCGAACAC
TCGGAGATGCTNATTATACGGAGTANCCACACATAATATACATGCGGAGANAATCTTATC
NAGCAAAACGAGGGAANAATTTATNATATTGAGAAGGGGGANNAAAGCNGTTATNAATAT
AACTATTCCCAGAGAAGACATGTGTCGAACGTTAAACAAACGTTTTTGTAAACAATTCAN
GGTAATTCCCCCAAATATTTGTTGTATTCATTCAATGTACGTGTGCGACAATATGAACTT
TTTAACAACTTCCGAATGTATTATAGTCTAAATTGAAGTGATTACTAACTCATCATACAC
TTTAATCCGGGAATCAATCCCTTTCCACACCTTGCATTCGGAACCNCGATTCCTTNGTTA
CATNCCGATATTCACAACTAGATTTTNCCAAAAACTTCCTGAATNCANCTTGGGCANNTN
GGTGATCCNNTANCTNNGNNNTTGGNNCTNNNNNTTNTTNAAAANNAAACTTNNNNNNNN
NNNNNNNNNNANNANNNNNNNNNNNNNNNNNAANCCCNNNNNNNNNNNNNNGNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE