Detailed Information [103516]

Strain Information
DGRC Number 103516
Genotype with FlyBase Link w[*] P{w[+mW.hs]=GawB}NP0076 / FM7c
Genotype w* P{w+mW.hs=GawB}NP0076 / FM7c
Break points/Insertion Site 6E4
Map Viewer
Related Genes CG14430 ogre
Original Number 76
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP0076
NP line. Received from the National Institute of Genetics.
Balancer FM7c
Cluster id 192
General Information NP_lines
Embryonic Expression tr (DLT), cns, sg
Larval GFP cns, tr (DT)
Larval X-gal sg, tr
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np08095_0711
Strand Minus
Insertion Point 6724417
Chromosome Band X
Flanking Sequence
annttttngngcactgancttatttgtatacttcggtaagcttcggctatcgacgggacc
accttatgttatttcatcatgCTGTGTAGTAAAAGCCAGACATAAAAGGAAGCTGCAGTC
CCCCTTTATCAACCCCCTTTTTCTCTCTTTTCTTTCTCTCTCTCTCTCTTCCCCATCCCT
TTTAGGGAAGCAGTCCAAAAAGGAAGTTGCAAAAACAGGAGCAGCTGCTGCAACAAATGA
GATTTGCACATTTTAGTGAGCGAATTTCTCTGAGAGGAGCGCTTCTTACCAAGAAGCGCA
AACACACTGGGATAAAAATAAATACAATTCTACGTTCGTGCTCCTGCTCACGTACATGAG
TCCGCCGATATCGATACCACCGATACCTGATTCGAGTACTTTTGCGGCTTATGGCCTGGT
GAGGAGGGAGTGGCGGGGTGTGTGTGGTTAATGGACCCGATTGCGACAGACGTGACACTT
GGCCAAGTGAAAGGGACCACCAATGATACCATTGTCCGCATGTTTTCGGCATTTTCGTGT
GGGGACAGTATGTGTTAAGAGAATATATCTGGTTGCTGACATTTGATTGCACATGTGCGA
GTCGATTTAAAGGGTAAATATCAAATGGAAATAATCATCAAACATTTTAATTAAATGCTT
AAGGTATGTGACATCTGTCTCTACACGGGGCATNTTTTNTTGAGCGGACAACGGGTTTTG
TCCAGTACCGGAGTATTCTGNGGGGGGGGNGAAACAAGGCGGGGTTACAAAATNTTCGGA
AACCCCAAATTTCAAACTTCaatttngnggtcaatttactcgcttttcatggnccggggc
aatgacagcgcacttaacatttttttccacctctacaggttttttnttttttgggggngg
ggggtttaagggaagggggggnnnnnnnnnntttngnnccccccaaagggncnnnttttt
ttggggncccnaaaaagggccttttnaaaananggnncccn

Library Name / Clone Name np / np08105_0711
Strand Minus
Insertion Point 6724417
Chromosome Band X
Flanking Sequence
atttttngtgcactgantttaattgtatacttcggtaagcttcggctatcgacgggacca
ccttatgttatttcatcatgCTGTGTAGTAAAAGCCAGACATAAAAGGAAGCTGCAGTCC
CCCTTTATCAACCCCCTTTTTCTCTCTTTTCTTTCTCTCTCTCTCTCTTCCCCATCCCTT
TTAGGGAAGCAGTCCAAAAAGGAAGTTGCAAAAACAGGAGCAGCTGCTGCAACAAATGAG
ATTTGCACATTTTAGTGAGCGAATTTCTCTGAGAGGAGCGCTTCTTACCAAGAAGCGCAA
ACACACTGGGATAAAAAATAAATACAATTCTACGTTTCGTGCTCCTGCTCACGTACATGA
GTCCCGCCGATATCGATACCCACCCGATACCCTGATTTCGAGTACTTTTTGCGGGCTTAT
GGCCCTGGTGAGGAGGGGAGTGGCGGGGTGTGTNTNGTTTAATGGANCCGATGGCGAACA
GAACGTGACACTTTGGCCCAAGTGAAAGGGTCCCACCCAATGGATACCCATTTGNCCCGC
ATTGTTTTTCNGGCATTTTCGGNGNGGGGNACCAGNTNGGTGGTTAAAGAAGAAATATTA
TTCTGGTTGGCTGACATTTTGGATTGGCACATGGTGCCGAAGTTCGATTTAAAGGGTAAA
TTATCNAATNGGAAAATAATCATCAAACCTTTNAATTAAAGCCTTAAGNTATTGGGACAT
NTGTCTNTACACNGGGCATTTTTTTTGAGCGGACNACNGGTTTTGTNCAGTACCGGAGTT
TTNTGGGGGGGGGGNGAAACaagcggggntacnaaaatttggnaaacccaaaatttnaaa
ctttaatttggnggtcnaattactcgcttntatgnnccggggcaatgacagcncattnan
attttttccanctttacaggttttttnttttttnggggggggggtttaagggaggggggn
tttttttttttttttnncccccaaagggcccnttttttgggggcccnaaaaagggcctgg
nag


CLOSE