Detailed Information [103517]

Strain Information
DGRC Number 103517
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}for[NP0079] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}forNP0079 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 24A2
Map Viewer
Related Genes for copia{}302
Original Number 79
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP0079
NP line. Received from the National Institute of Genetics.
Balancer CyUW14
Cluster id 1022
General Information NP_lines
Lethality lethal
Embryonic Expression cns, mid line
Larval GFP fb
Larval X-gal sg
Adult GFP abdomen
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np52265_0227
Strand Plus
Insertion Point 3624826
Chromosome Band 2L
Flanking Sequence
gggggnnngnnngttnngtttttttnnnnganttcttggtgncactgncnttattgtata
cttncggtaagncttcggctatcgacgggnaccaccttatgttatttcatcatgGTGGGG
ACAGCTGAGCACGTTTTGTTTGGTTGTGGGCGAGAGCCCCAGAgatcgaagaatacataa
gagagaaccgtcgccaaagaacccattattgttggggtccgttttcaggaagggcaagcc
atccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatccctgggcataaa
atccaacggaattgtggagttatcatgatgagctgccgagtcaatcgatacagtcaactg
tctttgacctttgttactactctcttccgatgatgatgtcgcacttattctatgctgtct
caatgttagaggcatatcagtctccactgaagccatcttatctgtctactnngttgcnat
gatgatgtnnnncttattctntgctgnntcaatgttanaggnatatnannnntgcactga
anccanttatctgtgntgnntnanngnnnaggnatntnnnnnnnnnntgnnnccntnnnn
nngnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnn

Image Files
Disc

d1 (->Large)

d2 (->Large)


CLOSE