Detailed Information [103518]

Strain Information
DGRC Number 103518
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}shn[NP0080] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype w*; P{w+mW.hs=GawB}shnNP0080 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 47D6
Map Viewer
Related Genes CG13230 shn
Original Number 80
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP0080
NP line. Received from the National Institute of Genetics.
Also known as NP80 P{GawB}NP80
Balancer CyUW14
Cluster id 671
General Information NP_lines
Embryonic Expression many cells, dorsal epi, good driver
Larval GFP fb
Larval X-gal sg, gut, fb
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np39025_0907
Flanking Sequence
ANAAAANNNCNNNNCNCCCCCNNNNNNNNNNNNNNNNNNNNNNAAAACNCNCCTCNCCCC
TCTACNCCNNCCCAACTTTCTCTNACTNCTCNNCNNAANNCTCCCCCNCTNCTCCCCCNN
CNNCCCNCCCCCCCCTCCCCACTCNCCCTCNANNNCCCCCNCCCCTCCNCNCCCCCNCNN
CCCNCNNNCNCCCCCCCCNCNCNNCCCNANCNCNCCCNCCNNNCCCCNNCCCCCCCACCC
CNCCTNCCCCNCANNCACCCCCNNCCCCNCCCNNCCNNCCCCCCCCNCCNCNNNCNCCCN
CNCNCCCCCCCACCCNCCNNCNCNNCCCCCCCCCCCCNNTCCCCCCCCNCCCNNTCCCAC
ACCCCCTNACCCNCCNNNNNCNCCCCCCCCCCCCCCCNCCTTCTCAACCNCCCAACCCCN
CNTCCCNCNCCCCCCCCCCCCNACTNNCCCCCCCTTCCCCCNNCCCCNCCACCCCCCCCC
CCCCCAAAAAGANCCCCCCCCCCNAAAAAAAAAACCCCCCCCCAAAGAACGNCCNCCCAA
NNNNTTTNTNTNTTAAGNAAAAAAAAAAGGANACCACAANCCCTNCTTTNNTTTGNGCGC
CNCNANCCANANAAAAACAAACAAANAANNCCCCTTTCTTCTTNTCTCTTTTTTTTTTNT
TTNTGGGGGGAGNNNAGGGTTTTTTTNTTTTAAAAAAAAAAAAAAAAAAAAAAANANNTT
TTTNTNTTTAATTTNTTTNNNCCCCCCCCCCCCCCNNCCNNAANAAAAAAAANNNNAAAA
AAAAAANAAAAAAAAAAAAAaanntanatgtannnccccatcaccccctcccaacaaaan
cagcacnaccaaaaaaaggggccccccnccttccacaaacnagggnanccactanannna
aacncanttnnntagnaaanangaaaaatgggtngtttnnnttacaaaanaacaaactaa
acctccctttttnngcnncggggcnnncgtnnggntttttaaanaagaagagggaaaaaa
tactttcctcccnaacnncnnnncnnnnnnacntttttcccaataatatatacannaggc
nnncnnaccncaggganagancnagggggggggggggggnccacacacnaaccaacacaa
aaacttccttccctaaataaananaaanagagatngntttaaaaattaaaaatttcncaa
aaatacaataanaaacaaaaanaaggtngnttttgnnnntgggcncggnacaanaataca
ccgnnnanacacgggacgacncaacagccnatattcacatcctttttttttttttttttt
tgnnntgggggggggggagagaccacncaacacgggccnacaaccacannaaanaaaaaa
nananagancggggtngtttccccnccctccccttttttcccggggggggcnnnncnncn
nanannncngnttttaccncnncggaacaananancnnacncnann

Library Name / Clone Name np / np64543_0309
Strand Plus
Insertion Point 6260263
Chromosome Band 2R
Flanking Sequence
tttcntncgcnttnntgcagncatacgttaatggntgtctcttgccgacgggcaccacct
tatgttatttcatcatgTGCCAAACCAATGTATGGCCGTTACGCATCTTGTTATTCTAGT
GTCTTTGGTATTACACAGCATACGGATACCGAATGCATGCACCTAGAGATACTTCAGATA
CTTGTTTAGCTATGTGGTTATACTGGGTGTCATGCAATACTATTTTAGATCNGGTNCCTN
NNGCTNGNGCTACTNGACANTACATNTATTAATCCAACNNGAGCANATANNAGCTCCTAC
CNTCTANTGACANTAGTAGCATGTANAACCCANNNCCCCACGNNCANGNNTNAAGAGGAN
AAATAATAATAGCTANTNTNTGTGNTGACTTNATNANAACNACNCCNNANAANANNNANG
NNNTNTAANCNANATNTNATATTNNNNTNANACNATANANNAANAGAGAANNNANAGAGN
NANNNNNNCNNCTTTTNNNNTNTTTATNANNATANANANGNANNNAGNNGTNNNNNNNAN
NTNNNNNTNTNTTNNTATNGNNNTTTTNNNNAGAATCANCNNNNNGNNNNNNNNNANCNN
NNNNNNCNNNNAATATTNCNGNNTNCTTTANTNANNATANNNGGNNNCNNNNNNNNGNNN
NNNNATNNNNATAATGNNATTNNNNTNNNANNANTNNNANNGNANTTTNNNGNNNANTNN
NCNCNNNANNNTANTANNACNNTNANNNNNANNNTNNAAANNNNNATNNNCNNNNNCANC
NTNTNNTNTTNANNANNTNNnnnncnnnnccannnataantnanannnagnnncnnannn
nnncnnannnnnnngnnanacnatnnannatatnagaannnnaaanatnnanaanntctc
annattgannnatnnnnnannantnncattnnntntancannnnnannnnnncan

Image Files
Disc

d1 (->Large)

d2 (->Large)
Embryo

e1 (->Large)

e2 (->Large)

e3 (->Large)


CLOSE