Detailed Information [103519]

Strain Information
DGRC Number 103519
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP0096 / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype w*; P{w+mW.hs=GawB}NP0096 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 61C9
Map Viewer
Related Genes CG13897 CR32482
Original Number 96
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP0096
NP line. Received from the National Institute of Genetics.
Original Comments comment1:B, comment2:66D1
Balancer TM6UW23-1
Cluster id 1733
General Information NP_lines
Embryonic Expression mesoderm
Larval GFP sg
Larval X-gal femur dorsal crescent, sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2016-02-04
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np41225_0907
Strand Plus
Insertion Point 720117
Chromosome Band 3L
Flanking Sequence
gngcctgaatttaagtgtatacttcggtaagcttcggctatcgacgggaccaccttatgt
tatttcatcatgCACCCATCAATTATAAAATCTCTCTGGAACGTTTTTCACTCGCCTTTT
GCAATATACACACATATTATTTGCGTTTTATTCTCGCGTGTTGTTATGGCTGATGTTGCT
GTTGTTGTTGCCGCTGCTGCTTGGCCAGATATTCAACTTGCGCTCGCACAGTGGGCCGAA
ATGCGTGAAAACCCTTGCTATATGGCGCACATGTGCTGGCCATGATGATAGGCCCGCCAA
GTATCTTCCCACCGGGGGAAGTTCCAAATATTTGCACAGCCGGACGCTNGACGGTTGGAC
GGNTGCAACATGTTGCCATCGGCGNAGCCCAAAAAGGCAGCCGGCCAAAAGCCGAGAGCA
ACACATGGTGNTGNAGCTAAGTCGGCGACAACAAGNGGACGTGGAAAATATGCCACAGNA
ATTATNTTCGNCTATNTTCATATNGCATATATAGCACATGGAGCAACATATTCATNTGCT
GGCCCCTGGNCNGATTTGCGCACCANTTTNGCTTGGCATTTCAAGGCATTGGTGNTGNTG
NTGNTATGCTGGTATNGTTGGCNCANGGTGGTGGTGGCANAANGTGCAGGTGGTGGCAAT
TTTGGTGGGCGGTCGGTTTNAAAANGNNAAACATNGNAAATTTCCTTGGGTANTTTAAAA
ATGCCAAATTGGCCTGGTNNGGGGAACCNTTNNNNAAAACCGNNCNCNAAAAAACCAATA
TTGGTGGGGGGCCCNTTTACagaaagggaaggcnttccaatttnattnnttttaaaacna
nnaaanncnngnngggcnncccgggcaanaaatncaaagggaattgggggg

Image Files
Disc

d1 (->Large)

d2 (->Large)

d3 (->Large)


CLOSE